View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17977_low_23 (Length: 201)
Name: NF17977_low_23
Description: NF17977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17977_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 186
Target Start/End: Original strand, 19423455 - 19423624
Alignment:
| Q |
17 |
aatatatcgttgcagtgtagcggggactagcttatcatcagcaccttgccatagatgaactttgatagtattatctggaaaagggttgtcaagatcaagt |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
19423455 |
aatatatcgttgcagcgtagcggggactagcttatcatcagcaccttgccatagatgaactttgattgtattatctgaaaaagggttgtcaagatcaagt |
19423554 |
T |
 |
| Q |
117 |
ggatcaaaatcccaagttccaaatccaattatcgtgtcacggcatatagattcatgctcaccttgttgtt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19423555 |
ggatcaaaatcccaagttccaaatccaattatcgtgtcacggcatatagattcatgctcaccttgttgtt |
19423624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University