View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17978_high_33 (Length: 283)

Name: NF17978_high_33
Description: NF17978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17978_high_33
NF17978_high_33
[»] chr3 (3 HSPs)
chr3 (18-98)||(42773127-42773207)
chr3 (144-263)||(42769779-42769892)
chr3 (213-252)||(42771113-42771152)
[»] chr1 (1 HSPs)
chr1 (220-250)||(19196092-19196122)


Alignment Details
Target: chr3 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 18 - 98
Target Start/End: Original strand, 42773127 - 42773207
Alignment:
18 ggtaagtcaaccaacttggaaccttaactcttttccaattaacgagttactctagataccgaccaaacatgttactcttct 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42773127 ggtaagtcaaccaacttggaaccttaactcttttccaattaacgagttactctagataccgaccaaacatgttactcttct 42773207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 144 - 263
Target Start/End: Complemental strand, 42769892 - 42769779
Alignment:
144 ggtgctatttctccactattttgctagttatgttaatgatgaaaaaataaaattgttgtnnnnnnnnncaatggtgaactgaataaacaaataaatgtta 243  Q
    ||||| ||||||||||||||||||||||||||||||||||| || ||||||| || |            ||||||||| ||||||||||| |||||||||    
42769892 ggtgccatttctccactattttgctagttatgttaatgatgtaataataaaactgat------taataaaatggtgaattgaataaacaagtaaatgtta 42769799  T
244 gagacacaccaaattaataa 263  Q
    ||||||||||| || |||||    
42769798 gagacacaccatatcaataa 42769779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 213 - 252
Target Start/End: Original strand, 42771113 - 42771152
Alignment:
213 aatggtgaactgaataaacaaataaatgttagagacacac 252  Q
    ||||||||| ||||||||||||||||||||||||| ||||    
42771113 aatggtgaattgaataaacaaataaatgttagagatacac 42771152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 220 - 250
Target Start/End: Original strand, 19196092 - 19196122
Alignment:
220 aactgaataaacaaataaatgttagagacac 250  Q
    |||||||||||||||||||||||||||||||    
19196092 aactgaataaacaaataaatgttagagacac 19196122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University