View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17978_high_38 (Length: 250)
Name: NF17978_high_38
Description: NF17978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17978_high_38 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 134 - 250
Target Start/End: Complemental strand, 9964305 - 9964189
Alignment:
| Q |
134 |
gtttctaatttcatgtacggcagttttcagcatgttcagcgtgctcacaagtgaaggaataaaaaacagaaagtattttggtgtacttgttttgtcttta |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9964305 |
gtttctaatttcatgtacggcagttttcagcatgttcagcgtgctcacaagtgaaggaataaaaaacagaaagtattttggtgtacttgttttgtcttta |
9964206 |
T |
 |
| Q |
234 |
ctacaattgcccaatca |
250 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9964205 |
ctacaattgcccaatca |
9964189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University