View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17978_high_38 (Length: 250)

Name: NF17978_high_38
Description: NF17978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17978_high_38
NF17978_high_38
[»] chr2 (1 HSPs)
chr2 (134-250)||(9964189-9964305)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 134 - 250
Target Start/End: Complemental strand, 9964305 - 9964189
Alignment:
134 gtttctaatttcatgtacggcagttttcagcatgttcagcgtgctcacaagtgaaggaataaaaaacagaaagtattttggtgtacttgttttgtcttta 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9964305 gtttctaatttcatgtacggcagttttcagcatgttcagcgtgctcacaagtgaaggaataaaaaacagaaagtattttggtgtacttgttttgtcttta 9964206  T
234 ctacaattgcccaatca 250  Q
    |||||||||||||||||    
9964205 ctacaattgcccaatca 9964189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University