View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17978_low_28 (Length: 320)
Name: NF17978_low_28
Description: NF17978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17978_low_28 |
 |  |
|
| [»] scaffold0212 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 12 - 165
Target Start/End: Complemental strand, 1132603 - 1132453
Alignment:
| Q |
12 |
gataatactaacattaataataactatttgatgtctcttgaatatcaatgtgtcgtgtttgtctttttgctcactcaattgatcattatatttagtaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
1132603 |
gataatactaacattaataataactatttgatgtctcttgaatatcaatgtgtggtgtttgtctttttgctcactcaattgatcagtatctttagtaacg |
1132504 |
T |
 |
| Q |
112 |
atcttattttaaaatattttttgtcatcgttgtcgtcatcatcatccttgttgt |
165 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
1132503 |
atcttattttaaaatattgtttgtcatcgtt---gtcatcatcatccttgttgt |
1132453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 193 - 303
Target Start/End: Complemental strand, 1132372 - 1132261
Alignment:
| Q |
193 |
cgaggacaaaaggcctgatagcagacatgagccaactctaaggagggcacccccgaatgcataagagaggggttggaaaagcacctcga-gagaagcttc |
291 |
Q |
| |
|
||||||||||| |||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1132372 |
cgaggacaaaaagccttatagcagatatgagccaactcaaaggagggcacccccgaatgcataagagaggggttggaaaagcacctcgaggagaagcttc |
1132273 |
T |
 |
| Q |
292 |
atttggaagttc |
303 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1132272 |
atttggaagttc |
1132261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0212 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 209 - 303
Target Start/End: Original strand, 1078 - 1172
Alignment:
| Q |
209 |
gatagcagacatgagccaactctaaggagggcacccccgaatgcataagagaggggttggaaaagcacctcgagagaagcttcatttggaagttc |
303 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||| || ||||||||||| || ||||||| |
|
|
| T |
1078 |
gatagcagacatgagccaactcaaaggagggcacccccgaacgcataagagaggggttggaaaaggaccccgtgagaagcttcagttagaagttc |
1172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 213
Target Start/End: Original strand, 54324 - 54352
Alignment:
| Q |
185 |
gttgcttacgaggacaaaaggcctgatag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54324 |
gttgcttacgaggacaaaaggcctgatag |
54352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University