View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17978_low_41 (Length: 241)
Name: NF17978_low_41
Description: NF17978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17978_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 9964124 - 9963923
Alignment:
| Q |
1 |
ttcccacttttggaacatcagattcgccaacgctggcctcgttgttcttgcaatccacgaggatgagcattgctgcatttatatatagnnnnnnnnngta |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
9964124 |
ttcccacttttggaacatgagattcgccaacgctggcctcgttgttcttgcaatccacgaggatgtgcattgctgcatttatatatag-ttttttttgta |
9964026 |
T |
 |
| Q |
101 |
agatgaggtgaagttcaaagtatatttatgaagatatctatagaacatcacgnnnnnnnntcctcactttggttacacaagtccacaattttatagatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9964025 |
agatgaggtgaagttcaaagtatatttatgaagatatctatagaacatcacgaaaaaaaatcctcactttggttacacaagtccacaattttatagatga |
9963926 |
T |
 |
| Q |
201 |
atc |
203 |
Q |
| |
|
||| |
|
|
| T |
9963925 |
atc |
9963923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University