View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17979_low_3 (Length: 250)
Name: NF17979_low_3
Description: NF17979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17979_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 22 - 194
Target Start/End: Complemental strand, 43456756 - 43456582
Alignment:
| Q |
22 |
aatttcttgattctaacagtatatatat--gtctgtatcaaatcaagttacacctgcagggatatcttattcccaagcggcctccagtggcagctatggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43456756 |
aatttcttgattctaacagtatatatatatgtctgtatcaaatcaagttacacctgcagggatatcttattcccaagcggcctccagtggcagctacggt |
43456657 |
T |
|
| Q |
120 |
actaatagtactatcacttcttctactgcaacaactactacttttactacttcttctggaagcagtagtaacatg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43456656 |
actaatagtactatcacttcttctactgcaacaactactacttttactacttcttctggaagcagtagtaacatg |
43456582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University