View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1797_low_4 (Length: 256)
Name: NF1797_low_4
Description: NF1797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1797_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 27147092 - 27146859
Alignment:
| Q |
1 |
caccttaagcaccttgaagaaaagatgataattttgccaccttgtattacaacaccaatatgaagtcttcatatatatccataatatttaatttttccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27147092 |
caccttaagcaccttgaagaaaagatgataattttgccaccttctattacaacaccaatatgaagtcttcatatatatccataatatttaatttttccaa |
27146993 |
T |
|
| Q |
101 |
caaactagctcagttcatacatggtcttcacttttaacatacagtggtgttgattatacaggaaataaatatcattacacctcaacattatttcagcttg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27146992 |
caaactagctcagttcata----gtcttcacttttaacatacagtggtgttgattatacagtaaataaatatcattacacctcaacattatttcaccttg |
27146897 |
T |
|
| Q |
201 |
tctactttgcctctaatctcatcttgtggaggtttttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27146896 |
tctactttgcctctaatctcatcttgtggaggtttttc |
27146859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University