View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17981_low_13 (Length: 353)
Name: NF17981_low_13
Description: NF17981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17981_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 148 - 340
Target Start/End: Original strand, 40855026 - 40855210
Alignment:
| Q |
148 |
gttacacttaatatctccttaaactttatatatagaaggtaattcgaaaagnnnnnnnnnnnnnntccaaattaagtaagtgtcacgcacattgtccccg |
247 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| | |
|
|
| T |
40855026 |
gttacactttatatctccttaaactttatatatagaaggtaattcgaaaagaaaaaaaaaa----tccaaattaag----tgtcacgcacattgtccctg |
40855117 |
T |
 |
| Q |
248 |
actccacaacaaaacgagcattatatttataggtcagaccatatcttttaaactctgatttatttagtatgtattatattattagttcattct |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40855118 |
actccacaacaaaacgagcattatatttataggtcagaccatatcttttaaactttgatttatttagtatgtattatattattagttcattct |
40855210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 15 - 73
Target Start/End: Original strand, 40854893 - 40854951
Alignment:
| Q |
15 |
aacggtttatgggatgtcggtgacaagatcgtgtaaagaagtaaaagtagggttacgtg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40854893 |
aacggtttatgggatgtcggtgacaagatcgtgtaaagaagtaaaagtagggttacgtg |
40854951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University