View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17981_low_16 (Length: 260)
Name: NF17981_low_16
Description: NF17981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17981_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 7906226 - 7905992
Alignment:
| Q |
10 |
tcgaagaaaatagaactatagatttggtgcatccttctgtacttgaagatctcaaaagcattgctaaagctatgtttgcttcaaattaccatcaggagtt |
109 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906226 |
tcgaagaaagcagtactatagatttggtgcatccttctgtacttgaagatctcaaaagcattgctaaagctatgtttgcttcaaattaccatcaggagtt |
7906127 |
T |
 |
| Q |
110 |
ttgtcatgtcttcattgcttctagaagagaagccttggctgagtactttgtcattctagaaatcgaaaaactaagcatcgaaagtgtgcttaaactggag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7906126 |
ttgtcatgtcttcattgcttctagaagagaagccttggctgagtactttgtcattctagaaatcgaaaaactaagcatcgaaagtgtgcttaaaatggag |
7906027 |
T |
 |
| Q |
210 |
tggcattgtttgaatagccggataaagaaatggat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906026 |
tggcattgtttgaatagccggataaagaaatggat |
7905992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University