View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17982_low_3 (Length: 379)
Name: NF17982_low_3
Description: NF17982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17982_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 6e-59; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 240 - 375
Target Start/End: Complemental strand, 16943894 - 16943759
Alignment:
| Q |
240 |
ttaagaatcttttcctaagataagcacatttatatattctttaaccatgttggaaaatgatcgcaattgacttttctatttctggtggaactaaagtatg |
339 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
16943894 |
ttaagaatcttttcctaagataagcacatatatttattctttaaccatgttggaaaatgatcgcaattgacttttctatttctggaggaactaaactatg |
16943795 |
T |
|
| Q |
340 |
cggttactgtcactgctatgaaacgaacaaattcca |
375 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16943794 |
cggttactgtcactgttatgaaacgaacaaattcca |
16943759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 16944149 - 16944024
Alignment:
| Q |
13 |
aaaatgattgtgggtatatcaatcctatatatggaattgaaagaatttatttcaaactcaaactctctagtagagaaaattaaatatattattattgtaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16944149 |
aaaatgattgtgggtatatcaatcctatatatgaaattgaaaaaaattatttcaaactcaaactctctagtagagaaaattgaatatattattattgtaa |
16944050 |
T |
|
| Q |
113 |
ccaattttcagatagttcacttagga |
138 |
Q |
| |
|
|||||||| |||||||||||| |||| |
|
|
| T |
16944049 |
ccaatttttagatagttcactaagga |
16944024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 134 - 167
Target Start/End: Complemental strand, 16943999 - 16943966
Alignment:
| Q |
134 |
taggaagatgacaactcttggatgccacaagtcc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16943999 |
taggaagatgacaactcttggatgccacaagtcc |
16943966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University