View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17983_high_9 (Length: 248)
Name: NF17983_high_9
Description: NF17983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17983_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 41475373 - 41475509
Alignment:
| Q |
1 |
catcttcgtttcattgagtaatcttcccgcacaaggtaacaccataatttctactctttaatcacttttatattctgatttgttcttaatcgattttttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41475373 |
catcttcgtttcattgagtaatcttcccgcacaaggtaacaccataatttctactctttaatcgcttttatattctgatttgttcttaatcgaatttttc |
41475472 |
T |
 |
| Q |
101 |
cctttttaccataacttatattcaatgaaaatgttaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41475473 |
cctttttaccataacttatattcaatgaaaatgttaa |
41475509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 40749348 - 40749390
Alignment:
| Q |
168 |
tttactgtctgtatctctttgtttatgtggctctttctttgga |
210 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
40749348 |
tttactgtttgtatctctttgtttgtgttgctctttctttgga |
40749390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University