View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17983_low_11 (Length: 248)

Name: NF17983_low_11
Description: NF17983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17983_low_11
NF17983_low_11
[»] chr2 (2 HSPs)
chr2 (1-137)||(41475373-41475509)
chr2 (168-210)||(40749348-40749390)


Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 41475373 - 41475509
Alignment:
1 catcttcgtttcattgagtaatcttcccgcacaaggtaacaccataatttctactctttaatcacttttatattctgatttgttcttaatcgattttttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||    
41475373 catcttcgtttcattgagtaatcttcccgcacaaggtaacaccataatttctactctttaatcgcttttatattctgatttgttcttaatcgaatttttc 41475472  T
101 cctttttaccataacttatattcaatgaaaatgttaa 137  Q
    |||||||||||||||||||||||||||||||||||||    
41475473 cctttttaccataacttatattcaatgaaaatgttaa 41475509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 210
Target Start/End: Original strand, 40749348 - 40749390
Alignment:
168 tttactgtctgtatctctttgtttatgtggctctttctttgga 210  Q
    |||||||| ||||||||||||||| ||| ||||||||||||||    
40749348 tttactgtttgtatctctttgtttgtgttgctctttctttgga 40749390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University