View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17983_low_14 (Length: 227)
Name: NF17983_low_14
Description: NF17983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17983_low_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 21 - 227
Target Start/End: Complemental strand, 41063437 - 41063231
Alignment:
| Q |
21 |
ggcataatgaagtcagtatcccaaagatgtaccttggcaaggatcttgacagcattcacacctttgatttctttgtgccggatataatgagcctgaaatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41063437 |
ggcataatgaagtcagtatcccaaagatgtaccttggcaaggatcttgacagcattcacacctttgatttctttgtgccggatataatgagcctgaaatt |
41063338 |
T |
 |
| Q |
121 |
ataccaccattacatagaagaagataaatctggatgctggagttcattgtatttacagcaaagatataattggcaattgccaatagcatacatcaatgag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41063337 |
ataccaccattacatagaagaagataaatctggatgctggagttcattgtatttacagcaaagatataattggcaattgccaatagcatacatcaatgag |
41063238 |
T |
 |
| Q |
221 |
gagttct |
227 |
Q |
| |
|
||||||| |
|
|
| T |
41063237 |
gagttct |
41063231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University