View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17983_low_17 (Length: 202)
Name: NF17983_low_17
Description: NF17983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17983_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 192
Target Start/End: Original strand, 35761677 - 35761849
Alignment:
| Q |
20 |
atgagcttgctcttctcatggaatcaaaaaagagggttatcccaattttctatgatgttaaaccttcccagcttgttgttaaggacaatggtacttgtcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35761677 |
atgagcttgctcttctcatggaatcaaaaaagagggttatcccaattttctatgatgttaaaccttcccagcttgttgttaaggacaatggtacttgtcc |
35761776 |
T |
 |
| Q |
120 |
tgttaaagagcttcgaaggtttagtgctgcattagaggaagctaaattcactgttggattaacctttgcttct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35761777 |
tgttaaagagcttcgaaggtttagtgctgcattagaggaagctaaattcactgttggattaacctttgattct |
35761849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University