View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17983_low_8 (Length: 256)
Name: NF17983_low_8
Description: NF17983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17983_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 240
Target Start/End: Complemental strand, 41063138 - 41062914
Alignment:
| Q |
16 |
atgaagtatgaacgactatgctagctggaacataacatttatggtttttggcaagtctgaacataatctcaagagggatcgatcaccacttaaagaattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41063138 |
atgaagtatgaacgactatgctagctggaacataacatttatggtttttggcaagtctgaacataatctcaagagggatcgatcaccacttaaagaattt |
41063039 |
T |
 |
| Q |
116 |
caataactaacatgaaatatgagtgagcgaatcccaaatatggatttcaacacgtcatgaaaactaaaatgctttttcatagcttgaagaggggctgcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41063038 |
caataactaacatgaaatatgagtgagcgaatcccaaatatggatttcaacacgtcatgaaaactaaaatgctttttcatagcttgaagaggggctgcat |
41062939 |
T |
 |
| Q |
216 |
gcagtcacgcaccagaagagcaaga |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41062938 |
gcagtcacgcaccagaagagcaaga |
41062914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University