View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17984_high_15 (Length: 234)
Name: NF17984_high_15
Description: NF17984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17984_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 58 - 218
Target Start/End: Complemental strand, 5063313 - 5063153
Alignment:
| Q |
58 |
atcgagtttcaacgaactcaaataaaagtgtcaaacataacaatatcaacgtttatctatcgatcagttgagttagatgttacggacaatgcgatataga |
157 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5063313 |
atcgagtttcaacgaactcgaagaaaagtgtcaaacataacaatatcaacgtttatatatcgatcagttgagttagatgttacggacaatgcgatataga |
5063214 |
T |
 |
| Q |
158 |
aaatgtattaatagaaggatggtgactcgtgatgtgggaacatggcagtgtttgtctcatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5063213 |
aaatgtattaatagaaggatggtgactcgtgatgtgggaacatggcagtgtttgtctcatg |
5063153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University