View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17984_high_15 (Length: 234)

Name: NF17984_high_15
Description: NF17984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17984_high_15
NF17984_high_15
[»] chr2 (1 HSPs)
chr2 (58-218)||(5063153-5063313)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 58 - 218
Target Start/End: Complemental strand, 5063313 - 5063153
Alignment:
58 atcgagtttcaacgaactcaaataaaagtgtcaaacataacaatatcaacgtttatctatcgatcagttgagttagatgttacggacaatgcgatataga 157  Q
    ||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
5063313 atcgagtttcaacgaactcgaagaaaagtgtcaaacataacaatatcaacgtttatatatcgatcagttgagttagatgttacggacaatgcgatataga 5063214  T
158 aaatgtattaatagaaggatggtgactcgtgatgtgggaacatggcagtgtttgtctcatg 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5063213 aaatgtattaatagaaggatggtgactcgtgatgtgggaacatggcagtgtttgtctcatg 5063153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University