View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17984_low_3 (Length: 467)
Name: NF17984_low_3
Description: NF17984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17984_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 2 - 330
Target Start/End: Original strand, 44842271 - 44842598
Alignment:
| Q |
2 |
gatgtcgccaccaacgataagatcccccgtacatcactttctttggtagcacttgacgaatgtctttgttcctatcaaagctatttttgatttcatagag |
101 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44842271 |
gatgtcgccaccaacgataagtccccccg-acatcactttctttggtagcacttgacgaatgtctttgttcctatcaaagctatttttgatttcataggg |
44842369 |
T |
|
| Q |
102 |
tataatgcattctattttataagaataactcaaattaagagatatcattcaagggaatactactagagttttttggctttctgctttgcactcatcaaac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44842370 |
tataatgcattctattttataagaataactcaaattaagagatatcattcaagggaatactactagagttttttggctttctgctttgcactcatcaaac |
44842469 |
T |
|
| Q |
202 |
taatctcttctatgtgttcagtatcccttatcatcagtatactcatataaacttcatttactttcaaattatcacggttctttttctaatgttctaccgg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44842470 |
taatctcttctatgtgttcagtatcccttatcatcagtatactcatataaacttcatttactttcaaattatcacggttctttttctaatgttctaccgg |
44842569 |
T |
|
| Q |
302 |
agcatatatttcaaattaccaacaataac |
330 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44842570 |
agcatatatttcaaattaccaacaataac |
44842598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University