View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17985_high_1 (Length: 468)

Name: NF17985_high_1
Description: NF17985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17985_high_1
NF17985_high_1
[»] chr4 (1 HSPs)
chr4 (1-207)||(53207388-53207593)


Alignment Details
Target: chr4 (Bit Score: 110; Significance: 3e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 53207388 - 53207593
Alignment:
1 gatatgatgggatggaagagctagaaggcttgtttgcatgtggaagtggggcttcnnnnnnnnnnnnnnnnncaattgaatgagacttatatacctgtaa 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||  ||                  ||||||||||||||||||||||| ||||    
53207388 gatatgatgggatggaagagctggaaggcttgtttgcatgtggaagtggg--ttttttttttttttttttttcaattgaatgagacttatataccggtaa 53207485  T
101 aattttattaagggttaggttgtcc-aactctcccaaaataatttcatgcaaaagcatcaaatatataaaatgagattaacatgctatatatttgtccaa 199  Q
    ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||    
53207486 aattttattaagggttaggttgtcccaactctcccaaattaatttcatgcaaaagcatcaaatatataaaatgagattaacatgttatatatctgcccaa 53207585  T
200 gggaagtc 207  Q
    ||||||||    
53207586 gggaagtc 53207593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University