View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17985_high_9 (Length: 306)
Name: NF17985_high_9
Description: NF17985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17985_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 861891 - 861593
Alignment:
| Q |
1 |
aaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatattgctgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
861891 |
aaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatattgctgac |
861792 |
T |
|
| Q |
101 |
tctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctacatttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
861791 |
tctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctacatttct |
861692 |
T |
|
| Q |
201 |
gctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgcctttgct-actccactcatatgccctatgct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | || |||||||||||||| |||| |
|
|
| T |
861691 |
gctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccctctgct |
861593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 1223168 - 1222870
Alignment:
| Q |
1 |
aaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatattgctgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223168 |
aaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgctatattgctgac |
1223069 |
T |
|
| Q |
101 |
tctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctacatttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223068 |
tctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggtatctacatttct |
1222969 |
T |
|
| Q |
201 |
gctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgcctttgct-actccactcatatgccctatgct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | || |||||||||||||| |||| |
|
|
| T |
1222968 |
gctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtctttgttgtcttcactcatatgccctctgct |
1222870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University