View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17985_low_1 (Length: 468)
Name: NF17985_low_1
Description: NF17985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17985_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 3e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 53207388 - 53207593
Alignment:
| Q |
1 |
gatatgatgggatggaagagctagaaggcttgtttgcatgtggaagtggggcttcnnnnnnnnnnnnnnnnncaattgaatgagacttatatacctgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
53207388 |
gatatgatgggatggaagagctggaaggcttgtttgcatgtggaagtggg--ttttttttttttttttttttcaattgaatgagacttatataccggtaa |
53207485 |
T |
|
| Q |
101 |
aattttattaagggttaggttgtcc-aactctcccaaaataatttcatgcaaaagcatcaaatatataaaatgagattaacatgctatatatttgtccaa |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||| |
|
|
| T |
53207486 |
aattttattaagggttaggttgtcccaactctcccaaattaatttcatgcaaaagcatcaaatatataaaatgagattaacatgttatatatctgcccaa |
53207585 |
T |
|
| Q |
200 |
gggaagtc |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
53207586 |
gggaagtc |
53207593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University