View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17986_high_12 (Length: 222)
Name: NF17986_high_12
Description: NF17986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17986_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 207
Target Start/End: Original strand, 14002801 - 14002995
Alignment:
| Q |
13 |
agcagagaaaggagagagatgcaaaagatgcagcatttgttaaagtagataataaaattagagcactttctgaggtgattataaggatgagaatggaagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14002801 |
agcagagaaaggagagagatgcaaaagatgcagcatttgttaaagtagataacaaaattagagcactttctgaggtgattataaggatgagaatggaagg |
14002900 |
T |
|
| Q |
113 |
aggaactaaaattgaaatcaaggaggttaacaaagaagcaaataaaaagggttgtgcttttacaccaaattttagacccaaaaaatgtttgaaag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14002901 |
aggaactaaaattgaaatcaaggaggttaacaaagaagcaaataaaaagggttgtgcttttacaccaaattttagacccaaaaaatgtttgaaag |
14002995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University