View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17986_low_11 (Length: 241)
Name: NF17986_low_11
Description: NF17986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17986_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 81 - 178
Target Start/End: Original strand, 43368729 - 43368826
Alignment:
| Q |
81 |
gtgtaaatttgaggtctcacacagtttatctacttccgaactttggtgtttgatgttgttatgaccgacgttaaccttcacattcttcttatgctggc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43368729 |
gtgtaaatttgaggtctcacacagtttatctacttccgaactttggtgtttgatgttgttatgaccgacgttaaccttcacattctttttatgctggc |
43368826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University