View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17987_high_1 (Length: 541)
Name: NF17987_high_1
Description: NF17987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17987_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 263 - 522
Target Start/End: Complemental strand, 17990924 - 17990665
Alignment:
| Q |
263 |
gaaattcttcttgtcatcaacacccttaccagttgaacttactgcatgtgctggaagatttgcatgcacctcacccatcttttcttcatggccaccttct |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17990924 |
gaaattcttcttgtcatcaacacccttaccagttgaacttactgcatgtgctggaagatttgcatgcacctcacccatcttttcttcatggccaccttct |
17990825 |
T |
 |
| Q |
363 |
ccatttggaacagtacgtgctgcacttgcatgcactgcaactagtacaacaaacaaaagaattgtactcaccttttccatctcactaaccttttgaacac |
462 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
17990824 |
ccatttggaatcgtacgtgctgcacttgcatgcactacagctagtacaacaaacaaaagaattgtactcaccttttccatcttacttaccttttgaacac |
17990725 |
T |
 |
| Q |
463 |
tttgtttcggcttttcagtaggaaaaacttgatatgatgttgtagattgcatgcacaaac |
522 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17990724 |
tttgtttcggtttttcagtaggaaaaacttgatatgatgttgtagattgcatgcacaaac |
17990665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University