View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17987_low_16 (Length: 213)
Name: NF17987_low_16
Description: NF17987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17987_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 19162955 - 19163165
Alignment:
| Q |
1 |
aaaaaacaacgaaacaaatataaattcttcaaaactgaactggtatttcttttctcatgtttttgttgattcaatactgataagatcacaaactcaacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19162955 |
aaaaaacaacgaaacaaatataaattcttcaaaactcaactggtatttcttttctcatgtttttgttgattcaataccgataagatcacaaactcaacag |
19163054 |
T |
 |
| Q |
101 |
taagcgattttcaagcgtcgattttaagaattttttatacttatatttgctttaattatgtgaatgcaggagctaccagataacatctttgctttattga |
200 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19163055 |
taagctattttcaagcatcgattttaagaattttttatacttatatttgctttaattatgtgaatgcaggagctaccagataacgtctttgctttattga |
19163154 |
T |
 |
| Q |
201 |
tgatgtccatc |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
19163155 |
tgatgtccatc |
19163165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University