View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17987_low_4 (Length: 438)
Name: NF17987_low_4
Description: NF17987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17987_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 45673139 - 45672915
Alignment:
| Q |
18 |
aattgaggtaacctcatggctgaagacggcgggtgtgttgttaccgtcggtggagcttgcacaccgccttgtgtctcacatctgttgggacaacaacgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673139 |
aattgaggtaacctcatggctgaagacggcgggtgtgttgttaccgtcggtggagcttgcacaccgccttgtgtctcacatctgttgggacaacaacgtt |
45673040 |
T |
|
| Q |
118 |
gctgtgacatggaaatacttagagaaagctatggaatcaagaatggttcctcctttccttgtcttggctctcctctccacaaaagtagtacccaacagac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45673039 |
gctgtgacatggaaatacttagagaaagctatggaatcaagaatggttcctcctttccttgtcttggctctcctctccacaaaagtagtacccaacagac |
45672940 |
T |
|
| Q |
218 |
accctcttcttcaccctccagctta |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45672939 |
accctcttcttcaccctccagctta |
45672915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 305 - 380
Target Start/End: Complemental strand, 45672852 - 45672777
Alignment:
| Q |
305 |
ctaattacccttctctcatgaactccattcatcaacttcttcgcctttcccaactctatcatgattcttcttctta |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45672852 |
ctaattacccttctctcatgaactccattcatcaacttcttcgcctttcccaactctatcatgattcttcttctta |
45672777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 398 - 433
Target Start/End: Complemental strand, 45672753 - 45672718
Alignment:
| Q |
398 |
accctggcgttgttcttgttcaatttcttctcactc |
433 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45672753 |
accctggcgttgttcttgttcaatttcttttcactc |
45672718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University