View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17988_high_21 (Length: 259)
Name: NF17988_high_21
Description: NF17988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17988_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 8569996 - 8569771
Alignment:
| Q |
18 |
tcttttctgattaaccgctctcaaagtacta-gaatatttggctatggaaatgcagaactttaatttcagtttgattgcttttgttaacaaatgtcagca |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8569996 |
tcttttctgattaactgctctcaaagtactaagaatatttggctatggaaatgcagaactttaatttcagtttgattgcttttgttaacaaatgctagca |
8569897 |
T |
 |
| Q |
117 |
acacactcctttggtgggttcatgtgaatttttaaccaatcaaaaatactatttacattttattttcattatagtaatgtgacatatgacaattgaaaca |
216 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8569896 |
acacactcttttcgtgggttcatgtgaatttttaaccaatcaaaaatactatttatattttattttcattatagtaatgtgacatatgacaattgaaaca |
8569797 |
T |
 |
| Q |
217 |
catgatgctttgatggatgcaaagaa |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8569796 |
catgatgctttgatggatgcaaagaa |
8569771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University