View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17988_high_22 (Length: 258)
Name: NF17988_high_22
Description: NF17988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17988_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 5 - 242
Target Start/End: Original strand, 8676106 - 8676343
Alignment:
| Q |
5 |
aatgatttgaacaccaattcagatttcaacacgaattattgctattaatgccagaatcattttttatcatgctcattaggagataaaaataaatttcttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8676106 |
aatgatttgaacaccaattcagatttcaacacgaattattgctattaatgccagaatcattttttatcatgctcattaggagataaaaataaatttcttt |
8676205 |
T |
 |
| Q |
105 |
gtataaatttctgattcacgcatcacaactatcataatttaaatgaaatacaatttttcgaggaggtttgaacttagtggaagagactagatttgcacaa |
204 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
8676206 |
gtatacatttctgattcacacatcacaactatcataatttaaatgaaatacaatttttcgaggaggtttgaacctagtggaagagactagatttgcccaa |
8676305 |
T |
 |
| Q |
205 |
tgtagcaaatttgaattccaaccgagagagatatattt |
242 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8676306 |
tgtagcaaatttgaattccaactaagagagatatattt |
8676343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 233
Target Start/End: Original strand, 8642500 - 8642554
Alignment:
| Q |
179 |
tagtggaagagactagatttgcacaatgtagcaaatttgaattccaaccgagaga |
233 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8642500 |
tagtgaaaaagactagatttgcacaatgtagcaaatttgaattccaacagagaga |
8642554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University