View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17988_low_1 (Length: 872)
Name: NF17988_low_1
Description: NF17988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17988_low_1 |
 |  |
|
| [»] chr8 (64 HSPs) |
 |  |
|
| [»] scaffold0178 (2 HSPs) |
 |  |  |
|
| [»] scaffold1086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0191 (1 HSPs) |
 |  |  |
|
| [»] scaffold0343 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold1990 (1 HSPs) |
 |  |  |
|
| [»] scaffold1112 (1 HSPs) |
 |  |  |
|
| [»] scaffold0533 (1 HSPs) |
 |  |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 613; Significance: 0; HSPs: 64)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 613; E-Value: 0
Query Start/End: Original strand, 151 - 872
Target Start/End: Complemental strand, 24777451 - 24776728
Alignment:
| Q |
151 |
gcttttacgtataaatctctcactgaaaccctaacc--gcgaaaacgttacatagtcgtcctggctttgtttagggttatatccacagcaaagcttcacc |
248 |
Q |
| |
|
||||||| ||| |||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24777451 |
gcttttaggtagaaatctctcagtgaaaccctaaccccgcgaaaacgttacatagtcgtcctggctttgtttagggttgtatccacagcaaagcttcacc |
24777352 |
T |
 |
| Q |
249 |
cttacggcagtctcctccactccgtattcgacattatcatgtccggggccaagaaaaaccaacctcctctcaagaaaaccaaaactcatcactttcaatc |
348 |
Q |
| |
|
| |||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24777351 |
cctacggcagcctcctccactccgtattcgacgttatcatgtccggcgccaagaaaaaccaacctcctctcaagaaaaccaaaactcatcaccttcaatc |
24777252 |
T |
 |
| Q |
349 |
cactccctccaaaagcatacgtacattctttcaaccactcaacaaccctattcctcccaaaaaccctgatactgaatctcctatcaagcttcctcaccaa |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24777251 |
cactccctccaaaagcatacgtacattctttcaaccactcaacagccctattcctcccaaaaaccctgatactgaatctcctatcaagcttcctcaccaa |
24777152 |
T |
 |
| Q |
449 |
acatcaacttcttcgacttcttctccatcttcttcgtcctcttccaccaatgttgttgaaatgaagaaacggatttcacttttgaagaagacaccgtcgg |
548 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24777151 |
acatcaacttcttcgacttcttctccatcttcttcgtcctcttccaccaatgttgttgaagtgaagaaacggatttcacttttgaagaagacaccgtcgg |
24777052 |
T |
 |
| Q |
549 |
agtttgatcctagttcaattgcatggtggaagaagggtgatccggtgccgtttctgttcctctcgttggcgttcgacatgatcaaggaagagaaagggag |
648 |
Q |
| |
|
||||||||| ||| || |||||||||||||||||||||| |||||||||||| |||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24777051 |
agtttgatcatagctcggttgcatggtggaagaagggtgaaccggtgccgtttttgtttctctcgttggcgtttgacatgatcaaggaagagaaagggag |
24776952 |
T |
 |
| Q |
649 |
gaatgcaatgtcggatattggttgtaatgttttgaggacagtgatgcatactacgcctggtgatttattaccagttgtgtatctattttcaaacaggatt |
748 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24776951 |
gaatgcgatgtcggatattggttgtaatgtcttgaggacagtgatgcatactacgcctggtgatttattaccagttgtgtatctattttcaaacaggatt |
24776852 |
T |
 |
| Q |
749 |
gctccaccgtatcaaggtttagaaatgggaattggtaaagctgctgttattaagacacttgctgaggcatgtggaaggactgagaaagacgttaaggaac |
848 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24776851 |
gctccaccgtatcaaggtttagaaatgggagttggtaaagctgctgttattaagacacttgctgaggcatgtggaaggactgagaaagacgttaaggagc |
24776752 |
T |
 |
| Q |
849 |
aatataaggttggtttgtttcttt |
872 |
Q |
| |
|
| ||||||||||||||||| |||| |
|
|
| T |
24776751 |
actataaggttggtttgttccttt |
24776728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 15042448 - 15042379
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
15042448 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
15042379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 39484453 - 39484385
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
39484453 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaatgccggacaccccacttattca |
39484385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 1033043 - 1032975
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| | |||||||||| |||||||||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
1033043 |
cagttggtgggacaatgcattattatatgcaggggtcggagttcgaac-ccgaacaccccacttattcac |
1032975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 4798624 - 4798555
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
4798624 |
cagttggtaggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
4798555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 13762595 - 13762526
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
13762595 |
cagttggtaggacaatgcattattatatgcaggggtcagtgttcgaaccacggacaccccacttattcac |
13762526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 17987532 - 17987463
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||| |||| ||||||| |||||||||||| |||||||| |
|
|
| T |
17987532 |
cagttggtaggataatgcattattatatgcaggggccggagttcgaaccccggacaccccaattattcac |
17987463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 43468788 - 43468719
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| | ||||||| ||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
43468788 |
cagttggtaggacaatgcattgttatatgtaggggtcggggttcgaactccggacaccccacttattcac |
43468719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 2696554 - 2696614
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
2696554 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
2696614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 2800040 - 2800100
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
2800040 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
2800100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 35301237 - 35301177
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
35301237 |
ggacaatgcattattatatgcaggggtcggggttcgaactccggacaccctacttattcac |
35301177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 108
Target Start/End: Complemental strand, 30942679 - 30942616
Alignment:
| Q |
45 |
ttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||| ||| |||||||||||||| |
|
|
| T |
30942679 |
ttgataggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttatt |
30942616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 42 - 108
Target Start/End: Original strand, 42688068 - 42688134
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
42688068 |
cagttggtaggacaatgcattattatatgtaggggtcgggattcgaaccccgaacaccccacttatt |
42688134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 9524969 - 9525038
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| || ||||||| |||||||||| |
|
|
| T |
9524969 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttattcac |
9525038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 107
Target Start/End: Original strand, 17980294 - 17980359
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
17980294 |
cagttggtaggacaaagcattattatatgcaggggccggggttcgaaccccggacaccccacttat |
17980359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 24608566 - 24608497
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| || ||||||| |||||||||| |
|
|
| T |
24608566 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttattcac |
24608497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 107
Target Start/End: Original strand, 43847714 - 43847779
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| ||| ||||||||||||| |
|
|
| T |
43847714 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttat |
43847779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 1588788 - 1588848
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
1588788 |
ggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcac |
1588848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 8740739 - 8740671
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| | ||||||| |||||||||| ||||||||| |
|
|
| T |
8740739 |
cagttggtaggacaatgcagtattatatgcaggggctgaggttcgaactccggacaccctacttattca |
8740671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 25139970 - 25139902
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||| ||||||| ||| ||| |||||||||||| |
|
|
| T |
25139970 |
cagttgttagaacaatgcattattatatgcaggggtcggggttcgaaccccgaacatcccacttattca |
25139902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 40249963 - 40249892
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacac--cccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| | ||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
40249963 |
cagttggtaggacaatgcattattatatgcagtgatcggagttcgaactccggacacctcccacttattcac |
40249892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 48 - 111
Target Start/End: Original strand, 8034548 - 8034611
Alignment:
| Q |
48 |
ataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||| ||||||||||||| | ||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
8034548 |
ataggacaatgcattattatatgcaggagccggggttcgaaccccgaacaccccacttattcac |
8034611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 44 - 111
Target Start/End: Complemental strand, 42762111 - 42762044
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
42762111 |
gttgataggacaatgcattactatatgcaggggtcgaggttcaaatcccggacaccccacttattcac |
42762044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 2376537 - 2376599
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | ||||||| ||||||| |||||||||||| |
|
|
| T |
2376537 |
taggacaatgcattattatatgcaggggtccgggttcgaacctcggacactccacttattcac |
2376599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 7540564 - 7540502
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| ||| | ||||| ||||||||||||| |
|
|
| T |
7540564 |
taggacaatgcattattatatgcaggggtcggggttctaaccctggacaacccacttattcac |
7540502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 10199818 - 10199756
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||| || ||||||||||||||||| |
|
|
| T |
10199818 |
taggacaatgcattattatatgcaggggccggggttcgaaccccaaacaccccacttattcac |
10199756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 25119227 - 25119289
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| |||||||||||||||| || ||||||| ||||||| |||||| |||||| |
|
|
| T |
25119227 |
taggacaatgcattattatatgcaggggttggggttcgaaccccggacatcccactcattcac |
25119289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 27558946 - 27558885
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
27558946 |
taggataatgcattattatatgcaggggtcgggattcgaac-ccagacaccccacttattcac |
27558885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 105
Target Start/End: Complemental strand, 41089232 - 41089170
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| || |||| ||||||||| ||||| |
|
|
| T |
41089232 |
agttggtaggacaatgcattattatatgcaggggtcggggtttgaacaccggacacctcactt |
41089170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 5184970 - 5184901
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||| | ||||||||||||||| || ||||||| | ||||||||||||||||||| |
|
|
| T |
5184970 |
cagttggtaggacaatggattattatatgcaggggctggggttcgaaccctggacaccccacttattcac |
5184901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 5570931 - 5570972
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
5570931 |
ttatatgcaggggtcggagttcgaaccccggacaccccactt |
5570972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 24074518 - 24074587
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||| | | ||||||| |||||||| ||||||||||| |
|
|
| T |
24074518 |
cagttggtaggacaatgcattattatatgtaggggttgaagttcgaacctcggacacctcacttattcac |
24074587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 26703973 - 26703904
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||||| |||||| ||| ||||| ||||||||||| |
|
|
| T |
26703973 |
cagttggtaggacaatgcattattatatgcaagggtcggggttcgaatcccgaacacctcacttattcac |
26703904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 28979038 - 28979107
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| ||||| | ||||||| |||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
28979038 |
cagttgatagggacatgcattgttatatgtaggggtcggaattcgaaccccggacacctcacttattcac |
28979107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 34073322 - 34073253
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
34073322 |
cagttggtaggataatgcattattatatgtaggggtcaaggttcgaaccccggacaccccacttattcac |
34073253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 36359781 - 36359732
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
36359781 |
tattatatgcaggggccggagttcgaatcccggacaccccacttattcac |
36359732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 36467967 - 36467898
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcgga-tttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| || ||||||||| |||||||||||||||||||| |||||||| | | ||| |||||||||||| |
|
|
| T |
36467967 |
cagttggtatgacaatgcattattatatgcaggggtcggagtttcgaactctgtacatcccacttattca |
36467898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 42761948 - 42761879
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| || ||||||||| ||||||||||||||| ||| ||||||| | |||||| |||||||||||| |
|
|
| T |
42761948 |
cagttggtatgacaatgcattattatatgcagggggcggggttcgaactctggacactccacttattcac |
42761879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 43875060 - 43874991
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| | ||||||| || |||||||||||||||||| |
|
|
| T |
43875060 |
cagttgataggacaatgcattattatatgtaggggctgaggttcgaacaccagacaccccacttattcac |
43874991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 7314754 - 7314814
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||| || ||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
7314754 |
ggacaatacattattatatgcaggggccgaggttcgaaccccggacaccccacttattcac |
7314814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 14012633 - 14012693
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
14012633 |
ggacaatgcattgttatatgcaggggccggggttcgaagtccggacaccccacttattcac |
14012693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 33570503 - 33570443
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
33570503 |
ggacaatgcattgttatatgcatgggtcggggttcgaacctcggacaccccacttattcac |
33570443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 111
Target Start/End: Original strand, 5323944 - 5324003
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||| |||||| || || |||||||| |
|
|
| T |
5323944 |
gacaatgcattattatatgcaggggtcggggttcgaaccccggactcctcagttattcac |
5324003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 110
Target Start/End: Original strand, 6064398 - 6064457
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
6064398 |
ggacaatgcattattatatgcaggggtcggggttcgaacctcggacacttcacttattca |
6064457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 111
Target Start/End: Original strand, 10310304 - 10310363
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| |||||||| ||| ||||||| || ||| ||||||||||||||||||||| |
|
|
| T |
10310304 |
gacaatgcattattatatacagaggtcggagtttgaatcccggacaccccacttattcac |
10310363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 37154548 - 37154595
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||||| ||||||| | |||||||||| |||||||| |
|
|
| T |
37154548 |
ttatatgcaggggtcggaattcgaaccctggacaccccatttattcac |
37154595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 53 - 111
Target Start/End: Original strand, 14683900 - 14683957
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
14683900 |
acaatgcattattatatgcaggg-tcggggttcgaaccccggacatcccacttattcac |
14683957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 51 - 109
Target Start/End: Original strand, 17110325 - 17110382
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||| ||| ||||||| ||||||||||| |
|
|
| T |
17110325 |
ggacaatgcattattatatgcaggggtcggggttcaaac-ccggacatcccacttattc |
17110382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 27822082 - 27822151
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggt-cggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| |||||||||||||||| ||||||| |||| || ||||||||||||||||| |
|
|
| T |
27822082 |
cagttggtaggataatgcattattatatgcaggggtccggattt-gaaccccaaacaccccacttattcac |
27822151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 31129326 - 31129383
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
31129326 |
ggacaatgcattattatatg---gggtcggggttcgaaccccggacaccccacttattcac |
31129383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 110
Target Start/End: Complemental strand, 44923378 - 44923312
Alignment:
| Q |
45 |
ttgataggacaatgcagtatt-atatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||||||| ||||||| |||||| ||||| ||||||| |
|
|
| T |
44923378 |
ttgataagacaatgcattatttatatgcaggggtcggggttcgaaccccggactccccatttattca |
44923312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 6978832 - 6978901
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||| || ||||||| || |||| ||| |||||||| |
|
|
| T |
6978832 |
cagttgataggataatgcattattatatgcaggggttggggttcgaaccacgaacactccatttattcac |
6978901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 110
Target Start/End: Complemental strand, 8349543 - 8349498
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| |||| ||||||| ||| |||||||||||||||| |
|
|
| T |
8349543 |
tatatgcaggggccggagttcgaactccgaacaccccacttattca |
8349498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 8350471 - 8350516
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
8350471 |
tatatgcaggggccggagttcgaacctcggacaccccacttattca |
8350516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 10970278 - 10970347
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||| || ||| ||| ||| ||||||||||||||||| |
|
|
| T |
10970278 |
cagttggtaggataatgcattattatatgcaggggctggggttcaaaccccgaacaccccacttattcac |
10970347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 13537383 - 13537326
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||| | ||||||||||| ||||| ||||||| || ||||||||||||||||| |
|
|
| T |
13537383 |
acaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttattca |
13537326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 13626931 - 13626874
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||| | ||||||||||| ||||| ||||||| || ||||||||||||||||| |
|
|
| T |
13626931 |
acaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttattca |
13626874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 111
Target Start/End: Complemental strand, 13702423 - 13702366
Alignment:
| Q |
54 |
caatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||| | |||||| ||||||||||| |
|
|
| T |
13702423 |
caatgcattattatatgcaggggtcggggttcgaacctcagacacctcacttattcac |
13702366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 17467310 - 17467358
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||| ||| || ||||| ||||||||||||||||||||| |
|
|
| T |
17467310 |
tattatatgcaggggccgggtt-cgaaccccggacaccccacttattcac |
17467358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 19957384 - 19957335
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
19957384 |
tattatatgcaggggacgaggttcgaaccccggacaccccacttattcac |
19957335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 23857407 - 23857338
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgca-ggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| |||| ||| ||||||| ||||||||| ||||||||| |
|
|
| T |
23857407 |
cagttggtaggacaatgcattattatatgcagggggccggggttcgaacctcggacacccgacttattca |
23857338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 38790647 - 38790586
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtc-ggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| | || ||||||| || |||||||||||||||||| |
|
|
| T |
38790647 |
ggacaatgcattattatatgcaggggccgggggttcgaaccccagacaccccacttattcac |
38790586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 111
Target Start/End: Original strand, 41616238 - 41616279
Alignment:
| Q |
70 |
gcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
41616238 |
gcaggggtcggaattcgaactccggacaccctacttattcac |
41616279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 110
Target Start/End: Original strand, 45536757 - 45536798
Alignment:
| Q |
69 |
tgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||| |||| ||||||| |||||||||||||||||||| |
|
|
| T |
45536757 |
tgcaggggccggagttcgaaccccggacaccccacttattca |
45536798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 6e-21; HSPs: 62)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 6e-21
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 32891293 - 32891361
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
32891293 |
cagttggtaggacaatgcattattatatgcaggggtcggttttcgaaccccggacaccccacttattca |
32891361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 44422126 - 44422188
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
44422126 |
taggacaatgcattattatatgcagggatcggagttcgaaccccggacaccccacttattcac |
44422188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 580866 - 580797
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
580866 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
580797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 10262751 - 10262820
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
10262751 |
cagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
10262820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 36520863 - 36520794
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
36520863 |
cagttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttattcac |
36520794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 9796910 - 9796977
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
9796910 |
cagttgat-ggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattca |
9796977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 44 - 111
Target Start/End: Original strand, 17154663 - 17154730
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
17154663 |
gttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
17154730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 52 - 110
Target Start/End: Original strand, 25731956 - 25732014
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
25731956 |
gacaatgcattattatatgcaggggtcggagttcgaacctcggacaccccacttattca |
25732014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 112
Target Start/End: Complemental strand, 24034135 - 24034066
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcacg |
112 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
24034135 |
agttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcggacactccacttattcacg |
24034066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 11133097 - 11133157
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
11133097 |
ggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
11133157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 17239913 - 17239981
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
17239913 |
cagttggtagaacaatgcattattatatgcaggggtcgggattcgaacctcggacaccccacttattca |
17239981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 29034997 - 29035057
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29034997 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
29035057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 4529832 - 4529777
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
4529832 |
atgcattattatatgcaggggtcggagttcgaactccgaacaccccacttattcac |
4529777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 42 - 108
Target Start/End: Original strand, 9802905 - 9802970
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
9802905 |
cagttgat-ggacaatgcattattatatgcaagggtcggggttcgaaccccggacaccccacttatt |
9802970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 8234875 - 8234806
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||||| || ||||||||| ||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
8234875 |
cagttggtaggacaatacattattatatgtaggggccggggttcgaaccccggacaccccacttattcac |
8234806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 16028191 - 16028122
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||| ||||||| || |||| ||||||||||||| |
|
|
| T |
16028191 |
cagttggtaggacaatgcattattatatgcagtggtcggggttcgaactccagacatcccacttattcac |
16028122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 19052687 - 19052626
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | ||||||| ||||||| |||||||||||| |
|
|
| T |
19052687 |
taggacaatgcattattatatgcaggggtcaggattcgaaccccggacatcccacttattca |
19052626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 22297535 - 22297466
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| || ||||||| |||||||||||| |||||||| |
|
|
| T |
22297535 |
cagttggtaggacaatgcattattatatgcaggggcaggggttcgaaccccggacaccccatttattcac |
22297466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 30474278 - 30474209
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| || ||||||| || |||||||||||||||||| |
|
|
| T |
30474278 |
cagttggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcac |
30474209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 107
Target Start/End: Complemental strand, 35502156 - 35502091
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||||||||| || |||| ||||||||||||||||| |
|
|
| T |
35502156 |
cagttggtaggacaatgcattattatatataggggtcggagtttgaactccggacaccccacttat |
35502091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 36665449 - 36665510
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
36665449 |
taggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattca |
36665510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 41699114 - 41699183
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| | |||| ||||||||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
41699114 |
cagttggtaggatattgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcac |
41699183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 44721787 - 44721718
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
44721787 |
cagttggtagaacaatgcattattatatgcaggggtcggggttcgaacctcggacaccccatttattcac |
44721718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 3037696 - 3037636
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
3037696 |
ggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcac |
3037636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 4157731 - 4157663
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||| | ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
4157731 |
agttggtaggacaatgcattattatatgtaggtgctggagttcgaaccccggacaccccacttattcac |
4157663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 9547210 - 9547142
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||| ||| |||||| ||| |||||||||||||||| |
|
|
| T |
9547210 |
cagttgataggacaatgtattattatatgcaggggccggggttcgaatcccgaacaccccacttattca |
9547142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 20122558 - 20122490
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||| ||| ||||||| |||||||| ||||||||||| |
|
|
| T |
20122558 |
cagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacacgccacttattca |
20122490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 111
Target Start/End: Original strand, 44187729 - 44187785
Alignment:
| Q |
55 |
aatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
44187729 |
aatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
44187785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 18386888 - 18386826
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||| ||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
18386888 |
taggacaatgcattattatatgtaggggctggggttcgaactccggacaccccacttattcac |
18386826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 110
Target Start/End: Original strand, 32891617 - 32891679
Alignment:
| Q |
48 |
ataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||||| | | |||||||||||||||| |
|
|
| T |
32891617 |
ataggacaatgcattattatatgcaggggttggggttcgaaccctgaacaccccacttattca |
32891679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 62 - 112
Target Start/End: Original strand, 43200872 - 43200922
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcacg |
112 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
43200872 |
tattatatgcaggggccggagttcgaaccccgaacaccccacttattcacg |
43200922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 1836600 - 1836669
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||| |||| ||||||| |||||||||| |||||||||| |
|
|
| T |
1836600 |
cagttggtaggacaatgcattattatatgaaggaatcggggttcgaaccccggacaccctacttattcac |
1836669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 2304311 - 2304368
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||| | ||||||||| ||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
2304311 |
ggacaatgtattattatatgtaggggtcggggttcgaaccccggacaccccacttatt |
2304368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 3179336 - 3179405
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
3179336 |
cagttggtagaacaatgcattattatatgcaggggtcgaggttcgaacctcagacaccccacttattcac |
3179405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 7086265 - 7086334
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||| ||||||| ||||||||||||||| ||| ||||||| ||| |||||||| |||||||| |
|
|
| T |
7086265 |
cagttggtagggcaatgcattattatatgcaggggccgggattcgaaccccgaacaccccaattattcac |
7086334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 10207657 - 10207726
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| |||||||||||| ||||||| || |||| |||||||| ||||||||||| |
|
|
| T |
10207657 |
cagttggtaggataatgcattattatatgcagtggtcggagtttgaactccggacacttcacttattcac |
10207726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 110
Target Start/End: Complemental strand, 17543146 - 17543105
Alignment:
| Q |
69 |
tgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
17543146 |
tgcaggggccggagttcgaacgccggacaccccacttattca |
17543105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 22538551 - 22538620
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| || |||||| ||| ||||| ||||||||||| |
|
|
| T |
22538551 |
cagttggtaggacaatgcattattatatgcaggggttggggttcgaatcccgaacacctcacttattcac |
22538620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 33613668 - 33613619
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
33613668 |
tattatatgcgagggtcggagttcgaaccccggacaccccacttattcac |
33613619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 36426932 - 36426871
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||||| |||||| || ||||||| ||| |||||||||||||||| |
|
|
| T |
36426932 |
taggacaatgcattattatatgtaggggttggggttcgaactccgaacaccccacttattca |
36426871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 111
Target Start/End: Original strand, 43870973 - 43871034
Alignment:
| Q |
50 |
aggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| ||||||||||||| | ||| |||||| ||||||||||||||||||||| |
|
|
| T |
43870973 |
aggacaatgcattattatatgcaggagccggggttcgaatcccggacaccccacttattcac |
43871034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 44487850 - 44487781
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| ||||| ||||||||||| ||| |||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
44487850 |
cagttgatagggacatgcattattatatgcaagggccggagttcgaaccccggacatcccacttattcac |
44487781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 9791978 - 9791910
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||| ||||| |||||| | |||||||||||||||||| |
|
|
| T |
9791978 |
cagttggtaggacaatgcattattatatgtaggtgtcggggttcgaattctggacaccccacttattca |
9791910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 111
Target Start/End: Original strand, 11837018 - 11837070
Alignment:
| Q |
59 |
cagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
11837018 |
cagtattatatgtaggggtcggggttcgaaccccggacacctcacttattcac |
11837070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 21970513 - 21970453
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||||||||||| |||| ||||||| ||||| ||||| ||||||||| |
|
|
| T |
21970513 |
ggacaatgcattattatatgcagggatcggggttcgaaccccggataccccgcttattcac |
21970453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 32527151 - 32527091
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| || |||| ||||||||||||| |
|
|
| T |
32527151 |
ggacaatgcattattatatgcaggggccggggttcgaaccccagacaacccacttattcac |
32527091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 13975163 - 13975210
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| || ||||| |
|
|
| T |
13975163 |
ttatatgcaggggtcggagttcgaactccggacaccccatttcttcac |
13975210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 108
Target Start/End: Original strand, 16973927 - 16973986
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||||| | |||||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
16973927 |
taggacaatggattattatatgcaggggttaggattcgaaccccggacaccccacttatt |
16973986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 17777198 - 17777155
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
17777198 |
tattatatgcaggggtcggggttcgaaccccggacaccccactt |
17777155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 110
Target Start/End: Original strand, 29664624 - 29664683
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||| | ||||||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
29664624 |
ggacaatgcattgttatatgcaggggtcggggttcaaatcccggacaccccacttattca |
29664683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 36413794 - 36413841
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||| |||| ||||||| | ||||||||||||||||||| |
|
|
| T |
36413794 |
ttatatgcaggggccggagttcgaaccctggacaccccacttattcac |
36413841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 37123212 - 37123267
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
37123212 |
atgcattattatatgcaggggtcgagattcgaactccggacaccctacttattcac |
37123267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 111
Target Start/End: Original strand, 1244604 - 1244650
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
1244604 |
tatatgcaggggtgggggttcgaaccccggacaccccacttattcac |
1244650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 111
Target Start/End: Original strand, 5207128 - 5207173
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
5207128 |
tatatgcaggggtcggatt-cgaaccccagacaccccacttattcac |
5207173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 111
Target Start/End: Original strand, 23405234 - 23405280
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
23405234 |
tatatgcaggggtcggggttcgaaccctggacaccccacttattcac |
23405280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 38530278 - 38530208
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcagggg-tcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||||| | || ||||||| |||||||||||||||||||| |
|
|
| T |
38530278 |
cagttggtaggacaatgcattattatatacaggggcttggggttcgaactgcggacaccccacttattcac |
38530208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 110
Target Start/End: Complemental strand, 3330257 - 3330216
Alignment:
| Q |
69 |
tgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
3330257 |
tgcagaggtcggagttcgaaccccggacaccccacttattca |
3330216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 17115627 - 17115558
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||| || | ||||||||||| ||||||| ||||||| ||||||| |||| |||||||| |
|
|
| T |
17115627 |
cagttggtaggacactgtattattatatgcaaaggtcggagttcgaaccccggacatcccatttattcac |
17115558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 111
Target Start/End: Original strand, 18255645 - 18255702
Alignment:
| Q |
54 |
caatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||| | ||||||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
18255645 |
caatgcatttttatatgcaggggccgagtttcgaacctcggacaccccacttattcac |
18255702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 107
Target Start/End: Complemental strand, 25050323 - 25050258
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||||||| ||||||| || ||||| | |||||| |
|
|
| T |
25050323 |
cagttggtaggataatgcattattatatgcaggggtcgggattcgaaccccagacacacaacttat |
25050258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 32943351 - 32943420
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| || || |||||| |||||||||||||||||||| |
|
|
| T |
32943351 |
cagttggtaggacaatgcattattatatgcagaggctggggttcgaatttcggacaccccacttattcac |
32943420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 42091357 - 42091289
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||| | |||| ||||||| ||| ||| ||||||||||||| |
|
|
| T |
42091357 |
cagttggtaggacaatgcattattatattcaggagccggagttcgaac-ccgaacaacccacttattcac |
42091289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 4e-19; HSPs: 52)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 12089109 - 12089178
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
12089109 |
cagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcac |
12089178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 12127992 - 12127923
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
12127992 |
cagttggtaggacaatgcattattatatgcaggggtcggaattcgaaccccggacacgccacttattcac |
12127923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 35190775 - 35190844
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
35190775 |
cagttggtagaacaatgcattattatatgcaggggtcggagttcgaaccccgaacaccccacttattcac |
35190844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 21507283 - 21507215
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||| | |||||||||||||||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
21507283 |
agttggtaggacaatgtattattatatgcaggggtcggagtttgaactccggacaccccacttattcac |
21507215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 52 - 110
Target Start/End: Original strand, 11636685 - 11636743
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
11636685 |
gacaatgcattattatatgcaggggtcggagttcgaaccccggacaccccactttttca |
11636743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 9438314 - 9438383
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| || ||||||| |||||||||||||| |||||| |
|
|
| T |
9438314 |
cagttggtaggacaatgcattattatatgcaggggttggggttcgaaccccggacaccccactcattcac |
9438383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 9491818 - 9491749
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
9491818 |
cagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacaccccacttattcac |
9491749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 22389833 - 22389764
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
22389833 |
cagttggtaggacaatgcattattatatgcaggggtcagggttcgaatcccggacaccccacttattcac |
22389764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 16251605 - 16251537
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
16251605 |
agttggtaggacaatgcacaattatatgcaggggtcgttgttcgaactccggacaccccacttattcac |
16251537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 42 - 112
Target Start/End: Complemental strand, 10377207 - 10377137
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcacg |
112 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| || ||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
10377207 |
cagttggtaggacaatgcattattatatgcagaggccggggttcgaaccccgaacaccccacttattcacg |
10377137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 110
Target Start/End: Original strand, 22983598 - 22983660
Alignment:
| Q |
48 |
ataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
22983598 |
ataggacaatgtattattatatgcaggggccggggttcgaaccccggacaccccacttattca |
22983660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 110
Target Start/End: Complemental strand, 23804810 - 23804748
Alignment:
| Q |
48 |
ataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
23804810 |
ataggacaatgtattattatatgcaggggccggggttcgaaccccggacaccccacttattca |
23804748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 5288428 - 5288359
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| | ||||| ||||||||| || |||||||| |
|
|
| T |
5288428 |
cagttggtaggacaatgcattattatatgcaggggtcggggtccgaactccggacacctcaattattcac |
5288359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 7563659 - 7563590
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||| ||||||||||| | ||| ||| ||||||||||||||||||||| |
|
|
| T |
7563659 |
cagttggtaggacaatgcattattacatgcaggggtcagggttcaaaccccggacaccccacttattcac |
7563590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 12101898 - 12101967
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||||| || ||||||||||||||| ||| ||||||| |||||||||| |||||||||| |
|
|
| T |
12101898 |
cagttggtaggacaatacattattatatgcaggggccggcgttcgaaccccggacaccctacttattcac |
12101967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 19642630 - 19642561
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| |||||| ||||||| || |||||||||||||||||| |
|
|
| T |
19642630 |
cagttggtaggacaatgcattattatatgcatcggtcggggttcgaaccccagacaccccacttattcac |
19642561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 30566070 - 30566139
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||| | | || |||| ||||||||||||||||||||| |
|
|
| T |
30566070 |
cagttggtaggacaatgcattattatatgcagaggttgaagtttgaaccccggacaccccacttattcac |
30566139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 34396095 - 34396164
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| || ||||||||| ||||||||||||||| |||| ||||||| |||||||||| | |||||||| |
|
|
| T |
34396095 |
cagttggtacgacaatgcattattatatgcaggggccggagttcgaactccggacaccctatttattcac |
34396164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 6143986 - 6144045
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
6143986 |
ggacaatgcattattatatgtaggggtcgggtt-cgaaccccggacaccccacttattcac |
6144045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 14981776 - 14981716
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| | ||||||||||||||||||| |
|
|
| T |
14981776 |
ggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccacttattcac |
14981716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 20716475 - 20716407
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||||||| ||||||| || || |||||||||||||| |
|
|
| T |
20716475 |
cagttggtaggacaatgcattattatatgtaggggtcgggattcgaactccagataccccacttattca |
20716407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 26528580 - 26528648
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
26528580 |
agttggtagaacaatgcattattatatgcaggggtcggggttcaaacctcggacaccccacttattcac |
26528648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 110
Target Start/End: Complemental strand, 6296989 - 6296923
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| ||||||| |||||| || ||||||||| |
|
|
| T |
6296989 |
gttgataggacaatgcattattatatgcaatggtcggaattcgaacctcggacatcctacttattca |
6296923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 110
Target Start/End: Complemental strand, 6303799 - 6303733
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| ||||||| |||||| || ||||||||| |
|
|
| T |
6303799 |
gttgataggacaatgcattattatatgcaatggtcggaattcgaacctcggacatcctacttattca |
6303733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 23771052 - 23771114
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| || ||||||| |||||||||||| |||||||| |
|
|
| T |
23771052 |
taggacaatgcattattatatgcaggggaaggggttcgaactccggacaccccatttattcac |
23771114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 25020604 - 25020542
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| ||||||||||||||| | | ||||||| ||||||||||||||||||||| |
|
|
| T |
25020604 |
taggacgatgcattattatatgcaggggcctgggttcgaaccccggacaccccacttattcac |
25020542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 3294799 - 3294848
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
3294799 |
tattatatgcaggggtcggggttcgaaccccggacaccccacttcttcac |
3294848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 9064887 - 9064944
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| || ||||||||||||||| |
|
|
| T |
9064887 |
ggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt |
9064944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 100
Target Start/End: Original strand, 10373608 - 10373665
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccc |
100 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
10373608 |
agttggtagaacaatgcattattatatgcaggggtcggggttcgaaccccggacaccc |
10373665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 18904766 - 18904697
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||| | ||| ||| ||||||| | ||||||||||||||||||| |
|
|
| T |
18904766 |
cagttggtaggacaatgcattattatatgtatgggccggggttcgaactctggacaccccacttattcac |
18904697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 19165363 - 19165431
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||| || ||||||| || |||||||||||||||||| |
|
|
| T |
19165363 |
cagttggtaggacaatgcattattatatgcagaggttggggttcgaac-cccgacaccccacttattcac |
19165431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 19279481 - 19279530
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||||||||||| |
|
|
| T |
19279481 |
tattatatgcaggggccggagttcgaacctcggacaccccacttattcac |
19279530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 109
Target Start/End: Original strand, 30833051 - 30833096
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
30833051 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttattc |
30833096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 49 - 109
Target Start/End: Complemental strand, 753388 - 753328
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
||||||||| || ||||||||| ||||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
753388 |
taggacaatacattattatatgtaggggtcggggttcgaaccctggacaccccacttattc |
753328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 6025469 - 6025402
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
6025469 |
cagttggtaggataatgcattattatatgcaggggtcgggattcgaaccccggaca-tccacttattca |
6025402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 18244095 - 18244028
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||| ||||||| ||||| |||| ||||||||| |
|
|
| T |
18244095 |
cagttggtaggacaatgcattattatatgcagaggtcggggttcgaac-ccggataccctacttattca |
18244028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 32057046 - 32057114
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| ||||||| || || | |||||||||||| |
|
|
| T |
32057046 |
cagttgataggacaatgcattattatatgcagtggtcgaggttcgaaccccagagatcccacttattca |
32057114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 107
Target Start/End: Original strand, 389370 - 389413
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| |||||||| |
|
|
| T |
389370 |
ttatatgcaggggtcggagttcgaaccccggacactccacttat |
389413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 978169 - 978126
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
978169 |
tattatatgcaggggtcggggttcgaacaccggacaccccactt |
978126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 110
Target Start/End: Original strand, 3448373 - 3448432
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||| | ||||| ||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
3448373 |
ggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccacttattca |
3448432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 105
Target Start/End: Original strand, 11982774 - 11982836
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||||| ||| | |||||| ||||||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
11982774 |
cagttggtagaataatgcattattatatgcaggggtcgggttt-gaaccccggacaccccactt |
11982836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 111
Target Start/End: Complemental strand, 24470464 - 24470405
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| |||||||| |||||| |||| ||||||| ||||| | ||||||||||||| |
|
|
| T |
24470464 |
gacaatgcattattatatacaggggccggagttcgaaccccggaaatcccacttattcac |
24470405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 30668253 - 30668198
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||| || ||||||||||||||||| |
|
|
| T |
30668253 |
atgcattattatatgcaggggtcagagttcgaaccacgaacaccccacttattcac |
30668198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 72 - 110
Target Start/End: Original strand, 17217000 - 17217038
Alignment:
| Q |
72 |
aggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
17217000 |
aggggtcggagttcgaactccggacaccccacttattca |
17217038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 111
Target Start/End: Complemental strand, 20568317 - 20568271
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
20568317 |
tatatgcaggggtcggggttcgaaccccgaacaccccacttattcac |
20568271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 22501030 - 22501100
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggt-cggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| ||| ||||||| | ||||||||||||||||| |
|
|
| T |
22501030 |
cagttggtaggacaatgcattattatatgcaggggtccgggattcgaaccaagaacaccccacttattcac |
22501100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 53 - 111
Target Start/End: Original strand, 29284141 - 29284199
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| | ||||||||| |||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29284141 |
acaatgtattattatatgtagggatcggggttcgaaccccggacaccccacttattcac |
29284199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 2945617 - 2945674
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||||| | ||||||||||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
2945617 |
ggacaatgcattgttatatgcaggggtcggggttcaaacctcggacaccccacttatt |
2945674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 10424617 - 10424549
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||||| ||||||||| |||||||| || ||| ||||||||||||||||||||| |
|
|
| T |
10424617 |
cagttgatag-acaatgcattattatatgtaggggtcgtggtttgaatcccggacaccccacttattcac |
10424549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 16801801 - 16801870
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||| || ||||||||||||| ||||| |||||| |||||||| |||||||||||| |
|
|
| T |
16801801 |
cagttggtaggacaaaacattattatatgcaggagtcggggttcgaattccggacacaccacttattcac |
16801870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 18631484 - 18631553
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||||| || | ||||||||||||||||| ||||||| || | ||||||||||||||| |
|
|
| T |
18631484 |
cagttggtaggacaatacattgttatatgcaggggtcgggattcgaaccccaaataccccacttattcac |
18631553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 18904302 - 18904343
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
18904302 |
ttatatgcaggggtcggggttcgaaccccggacaccccactt |
18904343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 4e-19; HSPs: 84)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 3465595 - 3465664
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
3465595 |
cagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcac |
3465664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 32885700 - 32885769
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
32885700 |
cagttggtaggacaatgcattattatatgcaggggtcggagttcgaacctcggacaccccacttattcac |
32885769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 50 - 111
Target Start/End: Original strand, 8690234 - 8690295
Alignment:
| Q |
50 |
aggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
8690234 |
aggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
8690295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 12856196 - 12856265
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||| |||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
12856196 |
cagttggtaggataatgcactattatatgaaggggtcggagttcgaaccccggacaccccacttattcac |
12856265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 37032254 - 37032193
Alignment:
| Q |
50 |
aggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
37032254 |
aggacaatgcattattatatgcaggggtcgggattcgaaccccggacaccccacttattcac |
37032193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 38433323 - 38433392
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| |||||| ||||||| || |||||||||||||||||| |
|
|
| T |
38433323 |
cagttgataggacaatgcattattatatgtaggagtcggagttcgaaccccagacaccccacttattcac |
38433392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 45350288 - 45350357
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
45350288 |
cagttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacaccccacttattcac |
45350357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 45359767 - 45359836
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
45359767 |
cagttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacaccccacttattcac |
45359836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 47018029 - 47017960
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
47018029 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
47017960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 42 - 108
Target Start/End: Complemental strand, 53698063 - 53697997
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
53698063 |
cagttgttaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatt |
53697997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 9924868 - 9924937
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
9924868 |
cagttggtaggacaacgcattattatatgcaggggtcggggttcgaaccccggacactccacttattcac |
9924937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 10098144 - 10098205
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
10098144 |
taggacaatgcattattatatgcaggggccgggattcgaaccccggacaccccacttattca |
10098205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 34773766 - 34773697
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
34773766 |
cagttgataggacaatgcattattatatgcaggggctgaggttcgaaccccggacaccccacttattcac |
34773697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 51077879 - 51077948
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| |||||| || ||||||||||||||||| |
|
|
| T |
51077879 |
cagttggtaggacaatgcattattatatgcaggggtcggagttcgaatctcgaacaccccacttattcac |
51077948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 13211435 - 13211367
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
13211435 |
cagttggtaggacaatgcattattatatgcatgggtcggggttcgaaccccggacactccacttattca |
13211367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 14149814 - 14149874
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
14149814 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
14149874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 28520805 - 28520745
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
28520805 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
28520745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 36954158 - 36954218
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
36954158 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccatttattcac |
36954218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 48968284 - 48968224
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
48968284 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
48968224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 52 - 111
Target Start/End: Complemental strand, 35451194 - 35451135
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
35451194 |
gacaatgcattattatatgcaggggtcggagttcgaactacggacacctcacttattcac |
35451135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 41 - 111
Target Start/End: Complemental strand, 35333072 - 35333002
Alignment:
| Q |
41 |
ccagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||| |||||||||||| |||||||||||| || |||| ||||||| ||| |||||||| |||||||| |
|
|
| T |
35333072 |
ccagttggtaggacaatgcattattatatgcagtggccggagttcgaactccgaacaccccatttattcac |
35333002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 26253964 - 26254033
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||| |||||| | |||||||||||||||||||| |||||| |||||||| |||||||||||| |
|
|
| T |
26253964 |
cagttggtagaacaatgtattattatatgcaggggtcggagttcgaatcccggacactccacttattcac |
26254033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 108
Target Start/End: Complemental strand, 42411528 - 42411471
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
42411528 |
ggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
42411471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 43115280 - 43115349
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||| | |||||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
43115280 |
cagttggtaggacaatgtattattatatgcaggggtcgagattcgaaccccggacaccccatttattcac |
43115349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 111
Target Start/End: Original strand, 9692987 - 9693043
Alignment:
| Q |
55 |
aatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
9692987 |
aatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
9693043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 21476164 - 21476096
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| | |||| |||||||||||||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
21476164 |
cagttgataggatattgcattattatatgcaggggtcgatgttcgaactccggacatcccacttattca |
21476096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 24234157 - 24234089
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||| ||||||| ||||||||||||||| ||| || |||| |||||||||||||||||||| |
|
|
| T |
24234157 |
cagttggtaggtcaatgcattattatatgcaggggccggggtttgaaccccggacaccccacttattca |
24234089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 52608650 - 52608583
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| || ||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
52608650 |
cagttggtaggacaatgcattattatatgcatggatcggagttcgaaccccggaca-cccacttattca |
52608583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 53815717 - 53815777
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
53815717 |
ggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcac |
53815777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 40 - 111
Target Start/End: Complemental strand, 548972 - 548901
Alignment:
| Q |
40 |
cccagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| ||| |||||| | |||||||||||||||||| |
|
|
| T |
548972 |
cccagttggtaggacaatgcattattatatgcaggggccggggttcgaaactcagacaccccacttattcac |
548901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 101
Target Start/End: Original strand, 5635201 - 5635260
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacacccc |
101 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||| ||| ||||||||||| |
|
|
| T |
5635201 |
cagttgctaggacaatgcattattatatgcaggggtcggggttcaaaccccggacacccc |
5635260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 51 - 110
Target Start/End: Original strand, 9084780 - 9084839
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||| | ||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
9084780 |
ggacaatgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttattca |
9084839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 33076556 - 33076611
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
33076556 |
atgcattattatatgcaggggtcggggttcgaaccccggacaccctacttattcac |
33076611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 62 - 109
Target Start/End: Original strand, 38690698 - 38690745
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
38690698 |
tattatatgcaggggtcggggttcgaaccccggacaccccacttattc |
38690745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 44272962 - 44273017
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
44272962 |
atgcattattatatgcaggggtcggagttcgaacctcggataccccacttattcac |
44273017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 49319419 - 49319474
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| ||||||||||||||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
49319419 |
atgcattattatatgcaggggtcggggttccaaccccggacaccccacttattcac |
49319474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 35747558 - 35747496
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | |||| ||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
35747558 |
taggacaatgtattattttatgcaggggtcgaggttcgaactccggacaccccacttattcac |
35747496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 111
Target Start/End: Original strand, 40150496 - 40150554
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
40150496 |
acaatgcattattatatacaggggtcggggttcgaaccccggacacctcacttattcac |
40150554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 44074872 - 44074934
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| |||||||||||||| | | | |||||| ||||||||||||||||||||| |
|
|
| T |
44074872 |
taggacaatgcattattatatgcagggattgaagttcgaatcccggacaccccacttattcac |
44074934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 111
Target Start/End: Original strand, 52031230 - 52031288
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
52031230 |
acaatgcattagtatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
52031288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 56314780 - 56314842
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | ||||||| |||||||| ||||||||||| |
|
|
| T |
56314780 |
taggacaatgcattattatatgcaggggtcagggttcgaaccacggacaccacacttattcac |
56314842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 56546525 - 56546463
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||| | |||||||||||||||||| |
|
|
| T |
56546525 |
taggacaatgcattattatatgcaggggccggggttcgaaccacagacaccccacttattcac |
56546463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 2565282 - 2565339
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||||| | |||||||||||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
2565282 |
ggacaatgcattgttatatgcaggggtcggagttcgaatcccgaacaccccacttatt |
2565339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 3442855 - 3442924
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||| ||| ||||||| || |||||||||||||||||| |
|
|
| T |
3442855 |
cagttggtaggacaatgcattattatatgtcggggccggggttcgaaccccagacaccccacttattcac |
3442924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 9172454 - 9172385
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||||| || |||||| || ||||||| |
|
|
| T |
9172454 |
cagttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcgaacaccctacgtattcac |
9172385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 17859790 - 17859859
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||| | ||||| |||| ||||||| ||| ||||| ||||||||||| |
|
|
| T |
17859790 |
cagttggtaggacaatgcattattatacgtaggggccggagttcgaaccccgaacacctcacttattcac |
17859859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 20753208 - 20753139
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||| ||||| ||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
20753208 |
cagttggtaggaaaatgcattattatatgtaggggccggggttcgaaccccggacaccacacttattcac |
20753139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 31601818 - 31601887
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||| |||||| | ||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
31601818 |
cagttggtagaacaatgtattattatatgcaggggccgagattcgaaccccggacaccccacttattcac |
31601887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 111
Target Start/End: Original strand, 36257722 - 36257775
Alignment:
| Q |
58 |
gcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
36257722 |
gcagtattgtatgcaggggccggggttcgaaccccggacaccccacttattcac |
36257775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 37889669 - 37889620
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
37889669 |
tattatatgcaggggtcggggttcgaaccccggacacctcacttattcac |
37889620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 53291454 - 53291523
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||| |||||||| || ||| |||||||||| |||||||||| |
|
|
| T |
53291454 |
cagttggtaggataatgcattattatatgcatgggtcggaatttgaatcccggacacccaacttattcac |
53291523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 107
Target Start/End: Complemental strand, 56531311 - 56531254
Alignment:
| Q |
50 |
aggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
||||||||||| | ||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
56531311 |
aggacaatgcattgttatatgcaggggccggggttcgaactccggacaccccacttat |
56531254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 23661441 - 23661373
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| | ||||||| |||||| || ||||||| ||| |||||||||||||||| |
|
|
| T |
23661441 |
cagttgctaggacaatgcattgttatatgtaggggtaggggttcgaaccccgaacaccccacttattca |
23661373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 36008296 - 36008356
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||| ||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
36008296 |
ggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccacttattcac |
36008356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 41003245 - 41003186
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | |||||||||||||| | | ||||||| ||||||||||||||||||||| |
|
|
| T |
41003245 |
ggacaatgcattgttatatgcaggggttg-agttcgaactccggacaccccacttattcac |
41003186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 79
Target Start/End: Original strand, 6365334 - 6365373
Alignment:
| Q |
40 |
cccagttgataggacaatgcagtattatatgcaggggtcg |
79 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
6365334 |
cccagttggtaggacaatgcattattatatgcaggggtcg |
6365373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Original strand, 10402476 - 10402519
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
10402476 |
tattatatgcaggggtcggagttcgaaccccggacacctcactt |
10402519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 111
Target Start/End: Complemental strand, 12820478 - 12820419
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| | ||||||||||||||||| || |||| | ||||||||||||||||||| |
|
|
| T |
12820478 |
gacaatgcattgttatatgcaggggtcggggttagaaccctggacaccccacttattcac |
12820419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 13578500 - 13578457
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
13578500 |
tattatatgcaggggtcggggttcgaaccccggacaccccactt |
13578457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 20266881 - 20266944
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggaca-ccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| | || || |||| ||||||| |||||||||||||| |
|
|
| T |
20266881 |
taggacaatgcattattatatgcaggggccagagtttgaaccccggacacccccacttattcac |
20266944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 21200564 - 21200611
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||| ||||||| |||| |||||||||||||||| |
|
|
| T |
21200564 |
ttatatgcaggggtcggggttcgaactccggtcaccccacttattcac |
21200611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 110
Target Start/End: Complemental strand, 29269389 - 29269330
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||| ||||||||| ||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
29269389 |
ggacaatgcattattatatgtaggggctgggattcgaaccccggacaccccacttattca |
29269330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 110
Target Start/End: Original strand, 30369359 - 30369425
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||| |||||||||||| | |||||||||||| | || ||||||| |||||||||||||||||||| |
|
|
| T |
30369359 |
agttggtaggacaatgcattgttatatgcagggc-cagaattcgaactccggacaccccacttattca |
30369425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 110
Target Start/End: Original strand, 43336974 - 43337041
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||| |||||| ||||||||| |||| |||| |||||| ||| |||||||||||||||| |
|
|
| T |
43336974 |
agttgataggagaatgcattattatatgtagggatcggggttcgaatcccgaacaccccacttattca |
43337041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 109
Target Start/End: Complemental strand, 46735052 - 46734985
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||||| |||| ||| ||| |||||||||||||||||| |
|
|
| T |
46735052 |
cagttggtaggacactgcattattatatgcagggatcggggttcaaacctcggacaccccacttattc |
46734985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 111
Target Start/End: Complemental strand, 2304398 - 2304352
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| || |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
2304398 |
tatatgcagcggccggagttcgaacgccggataccccacttattcac |
2304352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 67 - 105
Target Start/End: Original strand, 12625869 - 12625907
Alignment:
| Q |
67 |
tatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
12625869 |
tatgcaggggtcggagttcgaacaccggacaccccactt |
12625907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 80
Target Start/End: Complemental strand, 43606183 - 43606145
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcgg |
80 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
43606183 |
cagttgataggacaatgcattattatatgcagggatcgg |
43606145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 44 - 106
Target Start/End: Original strand, 48309159 - 48309221
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccactta |
106 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||| || ||||||| | | |||||| ||||| |
|
|
| T |
48309159 |
gttggtaggacaatgcattattatatgcaggggtctgagttcgaaccctgaacacccgactta |
48309221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 49280745 - 49280683
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||||||||| || |||| | ||||||| ||||||||||| |
|
|
| T |
49280745 |
taggacaatgaattattatatgcaggggtcggtgtttgaaccctggacacctcacttattcac |
49280683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 111
Target Start/End: Complemental strand, 52330969 - 52330923
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
52330969 |
tatatgcaggggccggggttcgaactccggacaccccacttattcac |
52330923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 88
Target Start/End: Complemental strand, 55266518 - 55266472
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaa |
88 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
55266518 |
cagttggtagaacaatgcattattatatgcaggggtcggagttcgaa |
55266472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 1297865 - 1297934
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||| || ||||||||||||||||||| ||||||| | | |||| |||||||||||| |
|
|
| T |
1297865 |
cagttggtaggacaacacattattatatgcaggggtcgggattcgaaccctgaacactccacttattcac |
1297934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 3544515 - 3544446
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| || ||| ||||||| |||||| ||| |||||||||| |
|
|
| T |
3544515 |
cagttggtaggacaatgcattattatatgcaaaggccggggttcgaaccccggactccctacttattcac |
3544446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 6053992 - 6054061
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| || ||||| ||| ||||||| |
|
|
| T |
6053992 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaactccaaacaccacacgtattcac |
6054061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 6637794 - 6637737
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||| || |||||||||||||||| || ||||||| ||| |||||||||||||||| |
|
|
| T |
6637794 |
acaatacattattatatgcaggggttggggttcgaaccccgaacaccccacttattca |
6637737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 7768851 - 7768802
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| || ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7768851 |
tattatatgcagaggccggggttcgaaccccggacaccccacttattcac |
7768802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 110
Target Start/End: Complemental strand, 11491275 - 11491234
Alignment:
| Q |
69 |
tgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||| |||| ||||||| |||||||||||||||||||| |
|
|
| T |
11491275 |
tgcaggggccggagttcgaaccccggacaccccacttattca |
11491234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 31578032 - 31578098
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||| |||||||||| |||| || |||||| ||||||||||||||||||||| |
|
|
| T |
31578032 |
agttggtaggacaatgcattattatatgc--gggttgggattcgaaacccggacaccccacttattcac |
31578098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 35803169 - 35803108
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| |||||||||||||| || | ||||||| | ||||||||||||||||| |
|
|
| T |
35803169 |
taggacaatgcattattatatgcagggaccgaagttcgaactctcgacaccccacttattca |
35803108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 110
Target Start/End: Complemental strand, 43362228 - 43362183
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||| |||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
43362228 |
tatattcaggggtcggggttcgaaccccggacaccccacttattca |
43362183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 47416480 - 47416549
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||| | |||||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
47416480 |
cagttggtaggataatggattattatatgcaggggttggggttcgaatctcggacaccccacttattcac |
47416549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 102
Target Start/End: Original strand, 53089669 - 53089718
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacacccca |
102 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| ||| |||||||| |
|
|
| T |
53089669 |
acaatgcattattatatgcaggggtcggagttcgaatcccgaacacccca |
53089718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 55656191 - 55656122
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| | ||||||| || ||||||||||||||| |||| ||| || |||||||||| |||||||||| |
|
|
| T |
55656191 |
cagttggttggacaatacattattatatgcaggggccggagttcaaatcccggacaccctacttattcac |
55656122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 4e-19; HSPs: 75)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 49146096 - 49146165
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
49146096 |
cagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
49146165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 32508877 - 32508808
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
32508877 |
cagttgataggataatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcac |
32508808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 23820641 - 23820709
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| |||| ||||||| || ||||||||||||||||| |
|
|
| T |
23820641 |
cagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccagacaccccacttattca |
23820709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 36331800 - 36331740
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
36331800 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
36331740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 45713493 - 45713561
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
45713493 |
agttggtaggacaatgcattattatatgtaggggccggagttcgaactccggacaccccacttattcac |
45713561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 52 - 111
Target Start/End: Original strand, 362965 - 363024
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
362965 |
gacaatgcattattatatgcaggggtcggagttcgaaccccggataccccacttattcac |
363024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 44 - 110
Target Start/End: Complemental strand, 13616155 - 13616089
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||| |||||||||||| ||||||||| |||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
13616155 |
gttggtaggacaatgcattattatatgtaggggtcggagttcgaacctcggacaccccacttattca |
13616089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 14417887 - 14417949
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
14417887 |
taggacaatgcattattatatgcaggggctggagttcgaaccccggacaccccacttattcac |
14417949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 35483288 - 35483350
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
35483288 |
taggacaatgcattattatatgcaggggtcggggttcgaatcccggacaccccacttattcac |
35483350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 16278034 - 16277965
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||| ||||| ||||||||||||||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
16278034 |
cagttggtaggaccatgcattattatatgcaggggtcgggattcgaactccggacatcccacttattcac |
16277965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 33206769 - 33206838
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
33206769 |
cagttggtaggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcac |
33206838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 43566879 - 43566810
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
43566879 |
cagttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcagacaccccacttattcac |
43566810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 9625004 - 9625064
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
9625004 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
9625064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 27183755 - 27183695
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
27183755 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
27183695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 36476380 - 36476440
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
36476380 |
ggacaatgcattattatatgcaggggccggagttcgaaccccgaacaccccacttattcac |
36476440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 42 - 108
Target Start/End: Complemental strand, 13540047 - 13539981
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||| || ||||||| |||||||||||||||||| |
|
|
| T |
13540047 |
cagttggtaggacaatgcattattatatgtaggggttggggttcgaaccccggacaccccacttatt |
13539981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 24751336 - 24751278
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
24751336 |
taggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttat |
24751278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 34344860 - 34344792
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | |||| || ||| ||||||||||||||||||||| |
|
|
| T |
34344860 |
cagttgataggacaatgcattattatatgcaggtgccggagtt-taaccccggacaccccacttattcac |
34344792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 42271096 - 42271027
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| | ||||||||||||| ||| ||||||| |||||||||| |||||||||| |
|
|
| T |
42271096 |
cagttggtaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccctacttattcac |
42271027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 49639040 - 49639109
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||| ||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
49639040 |
cagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccgaacaccccacttattcac |
49639109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 53467961 - 53468029
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
53467961 |
cagttggtaggacaatgcattattatatgcagggg-cggggttcgaacctcggacaccccacttattcac |
53468029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 14868706 - 14868766
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
14868706 |
ggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcac |
14868766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 63 - 111
Target Start/End: Original strand, 24559422 - 24559470
Alignment:
| Q |
63 |
attatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
24559422 |
attatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
24559470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 43774206 - 43774266
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
43774206 |
ggacaatgcattgttatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
43774266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 47191394 - 47191454
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
47191394 |
ggacaatgcattattatatgcaggggctggagttcgaaccccgaacaccccacttattcac |
47191454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 50724388 - 50724448
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
50724388 |
ggacaatgcattattatatgcaggggttggggttcgaacctcggacaccccacttattcac |
50724448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 50788460 - 50788400
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
50788460 |
ggacaatgcattattatatgcaggggttggggttcgaacctcggacaccccacttattcac |
50788400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 105
Target Start/End: Original strand, 41121883 - 41121946
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||| ||| ||| ||||||||||||||| |
|
|
| T |
41121883 |
cagttggtaggacaatgcattattatatgcagaggtcggggttcaaaccccggacaccccactt |
41121946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 68 - 111
Target Start/End: Complemental strand, 42665982 - 42665939
Alignment:
| Q |
68 |
atgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
42665982 |
atgcaggggtcggagttcgaactccggacaccccacttattcac |
42665939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 7448447 - 7448377
Alignment:
| Q |
42 |
cagttgatagg-acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||| ||| ||||||| || || ||||||||||||||| |
|
|
| T |
7448447 |
cagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttattcac |
7448377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 7456589 - 7456519
Alignment:
| Q |
42 |
cagttgatagg-acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||| ||| ||||||| || || ||||||||||||||| |
|
|
| T |
7456589 |
cagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttattcac |
7456519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 32665300 - 32665362
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||| ||||||||||| ||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
32665300 |
taggataatgcattattatatgcaagggtcggggttcaaactccggacaccccacttattcac |
32665362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 108
Target Start/End: Complemental strand, 47062149 - 47062084
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| ||||||||| | |||||||| ||||||| |||||||||||| ||||| |
|
|
| T |
47062149 |
cagttggtaggacaatgcattattatatg-atgggtcggagttcgaaccccggacaccccatttatt |
47062084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 111
Target Start/End: Complemental strand, 4072808 - 4072747
Alignment:
| Q |
50 |
aggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| | ||||||||||||| |||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
4072808 |
aggacaatgtattattatatgcaggagtcggagttcgaacttcggacacccctcttattcac |
4072747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 15498225 - 15498286
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||||| ||||| |||| ||||||| ||||||| ||||||||||| |
|
|
| T |
15498225 |
taggacaatgcattattatatgtaggggccggagttcgaaccccggacattccacttattca |
15498286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 27066642 - 27066691
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
27066642 |
tattatatgcaggggtcagggttcgaaccccggacaccccacttattcac |
27066691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 38176066 - 38176135
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||| ||| ||||||| || |||| ||||||||||||| |
|
|
| T |
38176066 |
cagttggtaggacaatgcaatattatatgctggggccggggttcgaaccccagacagcccacttattcac |
38176135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 99
Target Start/End: Original strand, 46754563 - 46754600
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacacc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46754563 |
tattatatgcaggggtcggatttcgaaccccggacacc |
46754600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 48173298 - 48173367
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| || ||||||||| ||||||||| | |||| ||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
48173298 |
cagttggtaagacaatgcattattatatgtatgggttggagttcgaaccccggacacctcacttattcac |
48173367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 335112 - 335044
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||| ||||||||| | || |||| ||||||| | ||||||||||||||||||| |
|
|
| T |
335112 |
agttggtaggacaatgcattattatatgtaaggaccggagttcgaaccctggacaccccacttattcac |
335044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 103
Target Start/End: Original strand, 3784091 - 3784143
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccac |
103 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
3784091 |
ggacaatgcattattatatacaggggtcggggttcgaaccccggacaccccac |
3784143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 10959154 - 10959214
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||||| ||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
10959154 |
ggacaatgcattattatatataggggccggggttcgaaccccggacaccccacttattcac |
10959214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 35477752 - 35477812
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||| |||||||| ||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
35477752 |
ggacattgcattattatatttaggtgtcggagttcgaactccggacaccccacttattcac |
35477812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 36727545 - 36727478
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
36727545 |
cagttggtaggacaatgcattattatatgca-aggtcggggttcgaacctcggacaccccacttattca |
36727478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 37279640 - 37279708
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| ||||| || |||||||||||| ||| || ||||||| || |||||||||||||||||| |
|
|
| T |
37279640 |
agttgatagaacaatacattattatatgcagaggttggggttcgaactccagacaccccacttattcac |
37279708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 52030142 - 52030202
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| | ||||||||||||||| ||| ||||||| |||||||||| |||||||||| |
|
|
| T |
52030142 |
ggacaatgtattattatatgcaggggccggggttcgaaccccggacaccctacttattcac |
52030202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 111
Target Start/End: Original strand, 53870859 - 53870915
Alignment:
| Q |
55 |
aatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||| |||||||||| ||||| || |||| ||||||||||||||||||||| |
|
|
| T |
53870859 |
aatgcattatgatatgcagggatcggaattagaactccggacaccccacttattcac |
53870915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 55195944 - 55195876
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||||| ||| ||||||| ||| ||||| || ||||||| |
|
|
| T |
55195944 |
cagttgataggacaatgcattatcatatgtaggggttggagttcgaactccgaacacctcatttattca |
55195876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 3955327 - 3955389
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggt--cggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
3955327 |
ggacaatgcattattatatgcaggggggccggggttcgaaccccggacaccccacttattcac |
3955389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 6951859 - 6951805
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
6951859 |
atgcattattatatgcaggggtcggattt-gaacctcggacaccgcacttattcac |
6951805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 111
Target Start/End: Complemental strand, 17440046 - 17439979
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| ||| || |||| |||| ||||||||||||||| |
|
|
| T |
17440046 |
gttggtaggacaatgcattattatatgcaggggccggtgtttgaacctcggataccccacttattcac |
17439979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Complemental strand, 24160589 - 24160542
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
24160589 |
ttatatgcaggggtcggggttcgaaccccggacactccacttattcac |
24160542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 24537861 - 24537908
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
24537861 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcac |
24537908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 111
Target Start/End: Original strand, 27739795 - 27739854
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| ||||||||| ||||| |||| || |||| |||||||||||| |||||||| |
|
|
| T |
27739795 |
gacaatgcattattatatgtaggggccggagtttgaaccccggacaccccatttattcac |
27739854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 28951892 - 28951947
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| ||||||||||||||||| | ||||||| ||| ||||||||||||||||| |
|
|
| T |
28951892 |
atgcattattatatgcaggggtcagggttcgaaccccgaacaccccacttattcac |
28951947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Original strand, 31586982 - 31587025
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
31586982 |
tattatatgcaggggtcggagttcgaatcccggacaccccactt |
31587025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Complemental strand, 31902266 - 31902219
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||| ||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
31902266 |
ttatatgtaggggtcggggttcgaactccggacaccccacttattcac |
31902219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 109
Target Start/End: Original strand, 40786292 - 40786359
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||||| ||||||| | ||| |||||||||||| |
|
|
| T |
40786292 |
cagttggtaggacaatgcattattatatgcatgggtcggggttcgaacctcagacgccccacttattc |
40786359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Complemental strand, 46328985 - 46328938
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
46328985 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcac |
46328938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 51017824 - 51017870
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
51017824 |
ttatatgcaggagtcggagttcgaac-ccggacaccccacttattcac |
51017870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 110
Target Start/End: Complemental strand, 4478437 - 4478383
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
4478437 |
atgcattattatatgcaggggtcggggttcgaatcccggacatcccacttattca |
4478383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 53 - 111
Target Start/End: Complemental strand, 9167343 - 9167285
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| | ||||||||||||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
9167343 |
acaatgtattattatatgcaggggtcggggttcgaacttcggacaccccagttattcac |
9167285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 20623853 - 20623791
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||| |||| || | ||||||| | ||||||||||||||||||| |
|
|
| T |
20623853 |
taggacaatgcattattatatgtagggatcagggttcgaactcaggacaccccacttattcac |
20623791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 108
Target Start/End: Complemental strand, 21420272 - 21420206
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||| |||||| | |||||||||||||||| |
|
|
| T |
21420272 |
cagttggtaggacaatgcattattatatgcagcggtcgaggttcgaatcctggacaccccacttatt |
21420206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 53 - 111
Target Start/End: Complemental strand, 28226259 - 28226201
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||| ||| ||||||||||||||||| |
|
|
| T |
28226259 |
acaatgcattattatatgcaggggttggggttcgaatcccgaacaccccacttattcac |
28226201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 76
Target Start/End: Original strand, 33072302 - 33072336
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcagggg |
76 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33072302 |
cagttgataggacaatgcattattatatgcagggg |
33072336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 110
Target Start/End: Complemental strand, 34407159 - 34407105
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||| |||||||||||||||| || ||||||| || ||||||||||||||||| |
|
|
| T |
34407159 |
atgcattattatatgcaggggttggggttcgaaccccagacaccccacttattca |
34407105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 108
Target Start/End: Original strand, 39492833 - 39492899
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||| || ||||||| || ||||||||||||||| |
|
|
| T |
39492833 |
cagttgttaggacaatgcattattatatgcatgggctggggttcgaaccccagacaccccacttatt |
39492899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 111
Target Start/End: Original strand, 45431658 - 45431708
Alignment:
| Q |
61 |
gtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
45431658 |
gtattttatgcaggggtcagggttcgaaccccggacaccccacttattcac |
45431708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 111
Target Start/End: Complemental strand, 54983765 - 54983719
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
54983765 |
tatatgcaggggtcggggttcgaaccccggacaccccatttattcac |
54983719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 16006589 - 16006520
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||| |||||||| ||| ||||||| | ||||| ||||||| || |||||||||||||||||| |
|
|
| T |
16006589 |
cagttggtagaacaatgcattataatatgcaagagtcggggttcgaaccccagacaccccacttattcac |
16006520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 95
Target Start/End: Original strand, 20244146 - 20244199
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccgga |
95 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| ||||| |
|
|
| T |
20244146 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccgga |
20244199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 79
Target Start/End: Complemental strand, 32876199 - 32876162
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcg |
79 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
32876199 |
cagttggtaggacaatgcattattatatgcaggggtcg |
32876162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 38682334 - 38682273
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||| || ||||||||||||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
38682334 |
taggacaatacattattatatgcaggggtcgggattcgaatcccggacaccctccttattca |
38682273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 50381749 - 50381794
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
50381749 |
tatatgcaggggtcggggttcgaatcccggacaccccacttattca |
50381794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 4e-19; HSPs: 69)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 19793538 - 19793607
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
19793538 |
cagttggtaggacaatgcattattatatgcaggggccggaattcgaaccccggacaccccacttattcac |
19793607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 15774395 - 15774326
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
15774395 |
cagttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttattcac |
15774326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 50 - 111
Target Start/End: Original strand, 38021272 - 38021333
Alignment:
| Q |
50 |
aggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
38021272 |
aggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcac |
38021333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 49251478 - 49251409
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
49251478 |
cagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
49251409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 15368817 - 15368885
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
15368817 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattca |
15368885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 29491491 - 29491551
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29491491 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
29491551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 538412 - 538343
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| |||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
538412 |
cagttggtagaacaatgcattattatatgcaggggccggagttcgaaccccgaacaccccacttattcac |
538343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 4354188 - 4354119
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
4354188 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaacttcggacaccccacttattcac |
4354119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 23464069 - 23464000
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
23464069 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttgttcac |
23464000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 37733767 - 37733836
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| || ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
37733767 |
cagttggtaggacaatgcattattatatgcagtggacggggttcgaaccccggacaccccacttattcac |
37733836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 11405477 - 11405537
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
11405477 |
ggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
11405537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 17350082 - 17350142
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
17350082 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
17350142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 49606781 - 49606713
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||| ||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
49606781 |
cagttgttaggacaatgcattattatatgtaggggccggagttcgaacttcggacaccccacttattca |
49606713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 42 - 108
Target Start/End: Complemental strand, 23930627 - 23930561
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||||| | |||||||||| ||||| |
|
|
| T |
23930627 |
cagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccctggacaccccatttatt |
23930561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 38020031 - 38019961
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcg-aacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| |||| |||| ||| || |||||||||||||||||| |
|
|
| T |
38020031 |
cagttggtaggacaatgcattattatatgcaggggccggagttcgaaaccccagacaccccacttattcac |
38019961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 107
Target Start/End: Complemental strand, 9408697 - 9408632
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
|||||| |||||||||||| ||||| |||||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
9408697 |
cagttggtaggacaatgcattattaaatgcaggggtcggagttcgaatcccggacaacccacttat |
9408632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 19424078 - 19424127
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
19424078 |
tattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
19424127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 30649105 - 30649174
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| || || ||||||| || |||||||||||||||||| |
|
|
| T |
30649105 |
cagttgataggacaacgcattattatatgcaggagttggggttcgaaccccagacaccccacttattcac |
30649174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 24014691 - 24014623
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| || ||||||||| ||||||||||||||| |||| ||||||| | |||||||||| ||||||| |
|
|
| T |
24014691 |
cagttggtaagacaatgcattattatatgcaggggccggagttcgaactctggacaccccaattattca |
24014623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 39238737 - 39238797
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
39238737 |
ggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccacttattcac |
39238797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 40678844 - 40678904
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||| | ||||||||||||||||||||| |
|
|
| T |
40678844 |
ggacaatgcattattatatgcaggggccggggttcgatccccggacaccccacttattcac |
40678904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 47763459 - 47763399
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||||| |||||| ||||||||||||| |
|
|
| T |
47763459 |
ggacaatgcattattatatgcaggggccggagttcgaacctcggacatcccacttattcac |
47763399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 48110541 - 48110609
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||||| ||| ||||||| |||||||| |||||||||| |
|
|
| T |
48110541 |
cagttggtagaacaatgcattattatatgcaggggttggagttcgaacctcggacacctcacttattca |
48110609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 64 - 111
Target Start/End: Complemental strand, 9768870 - 9768823
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
9768870 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
9768823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 44 - 111
Target Start/End: Complemental strand, 17056961 - 17056894
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| ||| ||||||| || ||| |||||||||||||| |
|
|
| T |
17056961 |
gttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacgccccacttattcac |
17056894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 3533049 - 3532988
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
3533049 |
taggacaatgcattattatatgtaggggtcgg-gttccaaccccggacaccccacttattcac |
3532988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 110
Target Start/End: Complemental strand, 11238097 - 11238043
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
11238097 |
atgcattattatatgcaggggtcggggttcgaatcccggacaccccacttattca |
11238043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 21884594 - 21884656
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| || ||||||| || |||||||||||||||||| |
|
|
| T |
21884594 |
taggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcac |
21884656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 27745176 - 27745238
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||| |||||||||||||| |||| ||||||| |||||||||||| |||||||| |
|
|
| T |
27745176 |
taggaaaatgcattattatatgcagggatcggggttcgaaccccggacaccccatttattcac |
27745238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 108
Target Start/End: Complemental strand, 43555957 - 43555891
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| |||| ||| ||| | |||||||||||||||| |
|
|
| T |
43555957 |
cagttggtaggacaatgcattattatatgcagggatcggggttcaaacccaggacaccccacttatt |
43555891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 48260257 - 48260203
Alignment:
| Q |
57 |
tgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
48260257 |
tgcattattatatgtcggggtcggagttcgaaccccggacaccccacttattcac |
48260203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 1721152 - 1721221
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| ||||| | ||||||||||||| ||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
1721152 |
cagttggtaggaacatgcattgttatatgcaggggccgggtttcgaaccccggacacctcacttattcac |
1721221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 8364491 - 8364422
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||| | |||||||| ||||||| ||| || |||||||||||||| |
|
|
| T |
8364491 |
cagttggtaggaaaatgcattattatatgtatgggtcggagttcgaaccccgaacgccccacttattcac |
8364422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 17871162 - 17871096
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||| ||| |||||| ||||||||| |
|
|
| T |
17871162 |
cagttgataggacaatgcattattatatgcaggg--cggggttcgaaccccgaacaccctacttattca |
17871096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 18923968 - 18923899
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| || | ||||||| |||||||||||| ||||||| |
|
|
| T |
18923968 |
cagttggtaggacaatgcattattatatgcagggttcagggttcgaacctcggacaccccacgtattcac |
18923899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 24662001 - 24662062
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | ||||||| || ||||||||| ||||||| |
|
|
| T |
24662001 |
taggacaatgcattattatatgcaggggtcaggattcgaaccccagacaccccatttattca |
24662062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 110
Target Start/End: Complemental strand, 29936737 - 29936696
Alignment:
| Q |
69 |
tgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
29936737 |
tgcaggggtcggagttcgaactccggacaccccacttattca |
29936696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 41677092 - 41677141
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
41677092 |
tattatatgcgggggtcggggttcgaactccggacaccccacttattcac |
41677141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 42831959 - 42832028
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||| |||| ||||||||||||||| || ||| ||| ||||||||||||||||||||| |
|
|
| T |
42831959 |
cagttggtaggacattgcattattatatgcaggggctggggttcaaaccccggacaccccacttattcac |
42832028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 43237792 - 43237853
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||| || ||||||| | ||||||||| ||||||| |
|
|
| T |
43237792 |
taggacaatgcattattatatgcaggggtcagagttcgaaccacagacaccccagttattca |
43237853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 107
Target Start/End: Complemental strand, 2052756 - 2052700
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
|||||||||| ||| ||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
2052756 |
ggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccacttat |
2052700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 13870155 - 13870095
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| || ||| ||||||||||||||||||||| |
|
|
| T |
13870155 |
ggacaatgcattattatatgcaggggccggggtttgaatcccggacaccccacttattcac |
13870095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 37490902 - 37490970
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| | ||||| |||||||||| |||||||| |
|
|
| T |
37490902 |
cagttggtaggacaatgcattattatatgcaggggccggggtacgaaccacggacaccccgcttattca |
37490970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 46116256 - 46116188
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||| ||| ||||||||||| || ||||||| |||||||||||| |||||||| |
|
|
| T |
46116256 |
agttggtaggacaatgcattatcatatgcaggggctggggttcgaaccccggacaccccaattattcac |
46116188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 52833180 - 52833120
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||| |||| |||||||| |
|
|
| T |
52833180 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacatcccatttattcac |
52833120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 3341805 - 3341750
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
3341805 |
atgcattattatatgcaggggccggggatcgaaccccggacaccccacttattcac |
3341750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 77
Target Start/End: Complemental strand, 5172685 - 5172650
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggt |
77 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5172685 |
cagttgataggacaatgcattattatatgcaggggt |
5172650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 7180649 - 7180606
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||||||||| |
|
|
| T |
7180649 |
tattatatgcaggggccggagttcgaaccccggacaccccactt |
7180606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 110
Target Start/End: Original strand, 9527447 - 9527506
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||| | ||||||||||||||||| || |||| | |||||||||||||||||| |
|
|
| T |
9527447 |
ggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttattca |
9527506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 77
Target Start/End: Complemental strand, 16110103 - 16110068
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggt |
77 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16110103 |
cagttgataggacaatgcattattatatgcaggggt |
16110068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 41182808 - 41182855
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
41182808 |
ttatatgcaggggtcggggtttgaaccccggacaccccacttattcac |
41182855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 42490445 - 42490402
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
42490445 |
tattatatgcaggggtcggggttcgaaccccggacaccccactt |
42490402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Original strand, 50119007 - 50119050
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||| ||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
50119007 |
tattttatgcaggggtcggagttcgaaccccggacaccccactt |
50119050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Complemental strand, 50199537 - 50199490
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
50199537 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcac |
50199490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 112
Target Start/End: Complemental strand, 11802103 - 11802033
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcacg |
112 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||| || ||||||| |||||||| || ||||||||| |
|
|
| T |
11802103 |
cagttggtaggacaatgcattattatatgtaggggttggggttcgaaccccggacacttcatttattcacg |
11802033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 18309567 - 18309629
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||| || ||| ||||||| || |||||||||| |
|
|
| T |
18309567 |
taggacaatgcattattatatgcaggggttggagttagaatcccggacatcctacttattcac |
18309629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 111
Target Start/End: Original strand, 32635175 - 32635221
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
32635175 |
tatatgcaggggttggggttcgaaccccggacaccccacttattcac |
32635221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 35111661 - 35111730
Alignment:
| Q |
42 |
cagttgatagga-caatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| ||| ||||||| || ||||||||||||||||| |
|
|
| T |
35111661 |
cagttgataggaacaatgcattattatatgcagggg-cggggttcgaacccctaacaccccacttattcac |
35111730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 6014599 - 6014532
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| || | |||||| ||||||||||||||||||||| |
|
|
| T |
6014599 |
cagttggtaggacaatgca-tattatatgcagggatca-agttcgaattccggacaccccacttattcac |
6014532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 110
Target Start/End: Complemental strand, 14262781 - 14262736
Alignment:
| Q |
65 |
tatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
14262781 |
tatatgcaggggtcggggttcgaaccccggacaccctacttattca |
14262736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 15051559 - 15051628
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||| ||||||| || ||| | ||||||||||||||||||| |
|
|
| T |
15051559 |
cagttggtagaacaatgcattattatatgcaagggtcggggtttaaactctggacaccccacttattcac |
15051628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 17889073 - 17889142
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||| | ||||||||||||| |||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
17889073 |
cagttggtaggataatgtattattatatgcaggaatcggggttcgaactccggacatcccacttattcac |
17889142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 24636736 - 24636805
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| || |||||| || ||||||||| ||| | |||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
24636736 |
cagttggtatgacaatacattattatatgtaggagccggagttcgaactccggacacctcacttattcac |
24636805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 111
Target Start/End: Complemental strand, 29106939 - 29106882
Alignment:
| Q |
55 |
aatgcagtattatatgcaggggtcggat-ttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||||||||||| | ||| ||| |||||||||||||||| |||||||| |
|
|
| T |
29106939 |
aatgcattattatatgcagggggccgatgttcaaacgccggacaccccatttattcac |
29106882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 39433370 - 39433439
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| || || |||||| ||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
39433370 |
cagttggtatgaaaatgcattattatatgcaggggccgatgttcgaacctcggacaccccacttattcac |
39433439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 101
Target Start/End: Complemental strand, 40814839 - 40814790
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacacccc |
101 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
40814839 |
gacaatgcattattatatgcaggggtcggggttcgaaacccggacacccc |
40814790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 109
Target Start/End: Original strand, 42908805 - 42908850
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
42908805 |
ttatatgcaggggtcggggttcgaactccggataccccacttattc |
42908850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 43837484 - 43837415
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| | || |||||||||||||| ||||||| | |||||||||| |||||||| |
|
|
| T |
43837484 |
cagttggtaggaaaatgcattcttctatgcaggggtcggggttcgaaccctggacaccccatttattcac |
43837415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 49916459 - 49916520
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| |||||| ||||||| |||| ||||||| |
|
|
| T |
49916459 |
taggacaatgcattattatatgtaggggtcggggttcgaatcccggacatcccatttattca |
49916520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 46; Significance: 9e-17; HSPs: 2)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 4335 - 4404
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
4335 |
cagttgataggacaatacattattatatgcaggggtcggggttcgaaccccggacactccacttattcac |
4404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 16078 - 16146
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||| ||||||| ||||||| || |||||||||| |
|
|
| T |
16078 |
agttgataggacaatgcattattatatgcagggatcggagttcgaaccccggacatcctacttattcac |
16146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 9e-17; HSPs: 52)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 2366369 - 2366438
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
2366369 |
cagttgataggacaatgcattattatatgcaggggtcggggttcgaactctagacaccccacttattcac |
2366438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 23685637 - 23685568
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||| || |||||||||||||||||| |
|
|
| T |
23685637 |
cagttgataggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttattcac |
23685568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 21086116 - 21086185
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| ||| | ||||||| |||||||||| |||||||||| |
|
|
| T |
21086116 |
cagttggtaggacaatgcattattatatgcagggatcgaagttcgaactccggacacccaacttattcac |
21086185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 50 - 111
Target Start/End: Original strand, 24396965 - 24397026
Alignment:
| Q |
50 |
aggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||| | |||||||| |||||||||| |
|
|
| T |
24396965 |
aggacaatgcattattatatgcaggggtcggagttcgaaccctggacaccctacttattcac |
24397026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 30644181 - 30644250
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| || |||||||||||||||||| |
|
|
| T |
30644181 |
cagttggtaggacaatgcattattatatgcaggggccggtgttcgaaccccagacaccccacttattcac |
30644250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 56 - 110
Target Start/End: Original strand, 32814853 - 32814907
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||| |||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
32814853 |
atgcattattatatgcaggggtcggagttcgaatcccggacaccccacttattca |
32814907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 44437901 - 44437843
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttat |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
44437901 |
taggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttat |
44437843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 25711214 - 25711145
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| |||||| ||||||||| ||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
25711214 |
cagttgataggataatgcattattatatgtaggggccggggttcgaacctcggacaccccacttattcac |
25711145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 27047798 - 27047729
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| ||||||||||| |||||||| |
|
|
| T |
27047798 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccatttattcac |
27047729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 30152753 - 30152822
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||| ||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
30152753 |
cagttggtaggacaatgcattattatatataggggtcggggttcgaaccccgaacaccccacttattcac |
30152822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 36316057 - 36315988
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
36316057 |
cagttggtaggataatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcac |
36315988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 38792224 - 38792293
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| || ||||||||| ||||||||||||||||| || || |||| |||||||||| |||||||||| |
|
|
| T |
38792224 |
cagttggtaagacaatgcattattatatgcaggggtcagagtttgaaccccggacaccctacttattcac |
38792293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 47552225 - 47552294
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||| ||| ||||||| |||||||||| |||||||||| |
|
|
| T |
47552225 |
cagttggtaggacaatgcattattatatgcaagggccggggttcgaaccccggacaccctacttattcac |
47552294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 21285427 - 21285367
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
21285427 |
ggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcac |
21285367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 55 - 110
Target Start/End: Complemental strand, 4042338 - 4042283
Alignment:
| Q |
55 |
aatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
4042338 |
aatgcattattatatgcaggggtcggagttcgaacttcggacacccaacttattca |
4042283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 11808072 - 11808119
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
11808072 |
ttatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
11808119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 52 - 111
Target Start/End: Complemental strand, 29658345 - 29658286
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| | ||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29658345 |
gacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcac |
29658286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 2261560 - 2261498
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| |||||| |||||||||| |||||||||| |
|
|
| T |
2261560 |
taggacaatgcattattatatgcaggggccggggttcgaatcccggacacccaacttattcac |
2261498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 43 - 109
Target Start/End: Complemental strand, 17900961 - 17900895
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| ||| |||||| |||||| |||||||||||| |
|
|
| T |
17900961 |
agttggtaggacaatgcattattatatgcaggggccggggctcgaaccccggactccccacttattc |
17900895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 22966034 - 22965972
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| || ||||||| || |||||||||||||||||| |
|
|
| T |
22966034 |
taggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcac |
22965972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 111
Target Start/End: Complemental strand, 24304355 - 24304297
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||| |||||||| |||||||| |
|
|
| T |
24304355 |
acaatgcattattatatgcaggggtcggggttcgaactccgaacaccccatttattcac |
24304297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 46337951 - 46337881
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggaca-ccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| |||| ||||||| | ||||| |||||||||||||| |
|
|
| T |
46337951 |
cagttggtaggacaatgcattattatatgcagggatcggggttcgaaccctggacacccccacttattcac |
46337881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 108
Target Start/End: Original strand, 46716345 - 46716411
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||| ||||||| | | |||||||||||||| |
|
|
| T |
46716345 |
cagttggtaggacaatgcattattatatgcagaggtcggggttcgaaccctgaacaccccacttatt |
46716411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 25818298 - 25818367
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||| ||| ||||||| ||| |||| |||||||||||| |
|
|
| T |
25818298 |
cagttggtaggataatgcattattatatgcaggggctggagttcgaaccccgaacactccacttattcac |
25818367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 31694091 - 31694148
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
31694091 |
ggacaatgcattattatatgcaggggacgagattcgaactccggacaccccacttatt |
31694148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 34948118 - 34948187
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||| |||||||| || || ||||||| ||||||||||||||||||||| |
|
|
| T |
34948118 |
cagttggtaggacaatgcattatcatatgcagtggccgaggttcgaaccccggacaccccacttattcac |
34948187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 20527503 - 20527443
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||| |||| ||||||| ||| ||||| ||||||||||| |
|
|
| T |
20527503 |
ggacaatgcattgttatatgcaggggccggagttcgaaccccgaacacctcacttattcac |
20527443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 83
Target Start/End: Original strand, 34234322 - 34234362
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatt |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
34234322 |
agttgataggacaatgcagtattatatgtaggggacggatt |
34234362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 38451884 - 38451944
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| | ||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
38451884 |
ggacaatgcattgttatatgcaggggccggggttcgaatcccggacaccccacttattcac |
38451944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 41139108 - 41139168
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
41139108 |
ggacaatgcattattatatgcaggggtcggggttcgaatcccggacacttcacttattcac |
41139168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 111
Target Start/End: Complemental strand, 41417337 - 41417289
Alignment:
| Q |
63 |
attatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
41417337 |
attatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
41417289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 48525599 - 48525658
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||||||| ||||||||| ||||||||||| |
|
|
| T |
48525599 |
ggacaatgca-tattatatgcaggggttggggttcgaaccccggacacctcacttattcac |
48525658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 9712233 - 9712190
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
9712233 |
tattatatgcaggggtcggggttcgaaccccggacaccccactt |
9712190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 14102487 - 14102542
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| ||||||||||||||| ||| || |||| ||||||||||||||||||||| |
|
|
| T |
14102487 |
atgcattattatatgcaggggccggggtttgaaccccggacaccccacttattcac |
14102542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 14412504 - 14412559
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| ||||||||||||||| ||| || |||| ||||||||||||||||||||| |
|
|
| T |
14412504 |
atgcattattatatgcaggggccggggtttgaaccccggacaccccacttattcac |
14412559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 14707326 - 14707373
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
14707326 |
ttatatgcaggggttggggttcgaaccccggacaccccacttattcac |
14707373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 21875663 - 21875620
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
21875663 |
tattatatgcaggggtcggagttcgaaccccggacactccactt |
21875620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 105
Target Start/End: Original strand, 30806150 - 30806193
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||||||| |
|
|
| T |
30806150 |
tattatatgcaggggtcggagttcgaaccccggacatcccactt |
30806193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 43635622 - 43635669
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
43635622 |
ttatatgcagcggtcggggttcgaaccccggacaccccacttattcac |
43635669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 5787480 - 5787542
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| || |||| || ||||||||||||||||| |
|
|
| T |
5787480 |
taggacaatgcattattatatgcaggggccggggtttgaaccccaaacaccccacttattcac |
5787542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 106
Target Start/End: Original strand, 7465492 - 7465542
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccactta |
106 |
Q |
| |
|
||||| ||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
7465492 |
atgcattattatatgcaggggccggggttcgaaccccggacaccccactta |
7465542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 111
Target Start/End: Complemental strand, 15716721 - 15716671
Alignment:
| Q |
61 |
gtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
15716721 |
gtattatatgcaagggtcggggttcgaacttcggacaccccacttattcac |
15716671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 29779000 - 29779062
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||| |||||||||||||||||||| ||||||| ||| | || ||||||||||| |
|
|
| T |
29779000 |
taggataatgcattattatatgcaggggtcggagttcgaactccgaatacttcacttattcac |
29779062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 108
Target Start/End: Complemental strand, 38778762 - 38778696
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| || ||| ||| ||||||| |||||||||| |
|
|
| T |
38778762 |
cagttggtaggacaatgcattattatatgcaggggccgaggttctaaccccggacatcccacttatt |
38778696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 8724392 - 8724461
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||| ||| || |||||||||||| |||||| |||||| |||||||||||||||||||| |
|
|
| T |
8724392 |
cagttggtaggataatacattattatatgcagaggtcgggaatcgaacctcggacaccccacttattcac |
8724461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 9351066 - 9351115
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| | || |||||||||||| |
|
|
| T |
9351066 |
tattatatgcaggggtcggagttcgaaccccgaaaactccacttattcac |
9351115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 22706111 - 22706042
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||| | ||||||||||||||| | ||| ||| ||||||||||||||||||||| |
|
|
| T |
22706111 |
cagttggtaggacaatgtattattatatgcaggggctgaggttcaaactccggacaccccacttattcac |
22706042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 109
Target Start/End: Original strand, 23799334 - 23799379
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
23799334 |
ttatatgcaggggtcgggattcgaacctcggacaccccacttattc |
23799379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 110
Target Start/End: Original strand, 31793507 - 31793548
Alignment:
| Q |
69 |
tgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
31793507 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
31793548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 110
Target Start/End: Original strand, 38025356 - 38025421
Alignment:
| Q |
45 |
ttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||||||| ||||||||||||| || || ||||||| |||||| ||||||||||| |
|
|
| T |
38025356 |
ttgataggacaatgcattattatatgcaggagttggggttcgaacctcggacattccacttattca |
38025421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 47880178 - 47880227
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
47880178 |
tattatatgcaggggccggggttcgaatcccggacaccccacttattcac |
47880227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 109
Target Start/End: Original strand, 48174993 - 48175046
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
||||| |||||||| |||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
48174993 |
atgcattattatatacaggggccggtgttcgaaccccggacaccccacttattc |
48175046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 9e-17; HSPs: 58)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 18872533 - 18872602
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
18872533 |
cagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcac |
18872602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 29096391 - 29096322
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29096391 |
cagttggtaggacaatgcattattatatgcaagggccggagttcgaaccccggacaccccacttattcac |
29096322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 42455477 - 42455408
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| |||| ||||||| |||||||| |||||||||||| |
|
|
| T |
42455477 |
cagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacactccacttattcac |
42455408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 4674889 - 4674829
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
4674889 |
ggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
4674829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 53 - 111
Target Start/End: Complemental strand, 36045206 - 36045148
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
36045206 |
acaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
36045148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 33800905 - 33800974
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| ||||||| || |||||||||||||||||| |
|
|
| T |
33800905 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttattcac |
33800974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 1463892 - 1463952
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
1463892 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
1463952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 2029210 - 2029142
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||| | ||||||||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
2029210 |
agttggtaggacaatgtattattatatgcaggggtcgggattcgaaccccgaacaccccacttattcac |
2029142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 2411377 - 2411309
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| |||||||||| | ||||||||||||||| |||| ||||||| || ||||||||||||||||| |
|
|
| T |
2411377 |
cagttggtaggacaatgtattattatatgcaggggccggagttcgaaccccagacaccccacttattca |
2411309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 23925555 - 23925623
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| | |||||| ||||| |||||||||||||| |
|
|
| T |
23925555 |
cagttgataggacaatgcattattatatgcaggggtctgggttcgaatcccggataccccacttattca |
23925623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 31556852 - 31556899
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
31556852 |
ttatatgcaggggtcggagttcgaaccccggacaccccacttattcac |
31556899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 20945967 - 20945905
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
20945967 |
taggacaatgcattattatatgcaggggccggggttcgaaatccggacaccccacttattcac |
20945905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 42 - 112
Target Start/End: Original strand, 29144154 - 29144224
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcacg |
112 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| || |||| || ||||||||| ||||||||| |
|
|
| T |
29144154 |
cagttggtaggacaatgcattattatatgcaggggtcggggtttgaactccagacaccccatttattcacg |
29144224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 32158490 - 32158428
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
32158490 |
taggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcac |
32158428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 843451 - 843382
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| || ||||||||| ||||||||| ||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
843451 |
cagttggtatgacaatgcattattatatgtaggggacggggttcgaaccccggacaccccacttattcac |
843382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 1244810 - 1244741
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||||| | ||||||| || |||||||||||||||||| |
|
|
| T |
1244810 |
cagttggtaggacaaagcattattatatgcaggggtcagggttcgaaccccagacaccccacttattcac |
1244741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 54 - 111
Target Start/End: Original strand, 10943740 - 10943797
Alignment:
| Q |
54 |
caatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
10943740 |
caatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
10943797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 18478015 - 18478084
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||| ||| ||||||| | ||||||||||||||||||| |
|
|
| T |
18478015 |
cagttggtaggacaatgcattattatatgctggggccggggttcgaaccctggacaccccacttattcac |
18478084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 19059087 - 19059018
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||| ||| ||||||| | ||||||||||||||||||| |
|
|
| T |
19059087 |
cagttggtaggacaatgcattatcatatgcaggggccggggttcgaaccctggacaccccacttattcac |
19059018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 19608625 - 19608694
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
19608625 |
cagttgataggaatatgcattattatatgcaggggtcggggttcgaactccggacacttcacttattcac |
19608694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 22600018 - 22599950
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| | |||||| |||| || |||||||||||||||||| |
|
|
| T |
22600018 |
cagttggtaggacaatgcattattatatgcagggttgggattt-gaaccccagacaccccacttattcac |
22599950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 30403762 - 30403831
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| ||||||||| || |||||||| |||||| |||| || |||| ||||||||||||||||||||| |
|
|
| T |
30403762 |
cagttggtaggacaatacattattatatacaggggccggagtttgaaccccggacaccccacttattcac |
30403831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 6447554 - 6447494
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
6447554 |
ggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcac |
6447494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Original strand, 13754018 - 13754086
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| ||||||||| || |||||||||||||||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
13754018 |
cagttggtaggacaatacattattatatgcaggggtcgatgttcgaacgtcggacaccccatttattca |
13754086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 98
Target Start/End: Complemental strand, 26169095 - 26169039
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacac |
98 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
26169095 |
cagttggtaggacaatgcattattatatgcaggggttggagttcgaaccccggacac |
26169039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 37303955 - 37304015
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||| | ||||||||||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
37303955 |
ggacaatgtattattatatgcaggggtcggggttcgaaccctggacaccccacttattcac |
37304015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 110
Target Start/End: Complemental strand, 42801524 - 42801456
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||| || || |||||| ||||||||||||||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
42801524 |
cagttggtatgataatgcattattatatgcaggggtcggggttcgaaccccggacacctcacttattca |
42801456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 52 - 111
Target Start/End: Complemental strand, 6806713 - 6806654
Alignment:
| Q |
52 |
gacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
6806713 |
gacaatgcattgttatatgcaggggtcgggattcgaaccccggacactccacttattcac |
6806654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 51 - 110
Target Start/End: Complemental strand, 9409024 - 9408965
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||| | |||||||||||||||||| ||||||| ||||||||| || ||||||| |
|
|
| T |
9409024 |
ggacaatgcattgttatatgcaggggtcggagttcgaaccccggacacctcatttattca |
9408965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 45 - 108
Target Start/End: Original strand, 29266083 - 29266146
Alignment:
| Q |
45 |
ttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| || ||||||| | |||||| |||||||| |
|
|
| T |
29266083 |
ttgataggacaatgcattattatatgcaggggtcagagttcgaacatcagacaccacacttatt |
29266146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 109
Target Start/End: Original strand, 29841360 - 29841427
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||| || ||||||| ||||||||||||||||||| |
|
|
| T |
29841360 |
cagttggtaggacaatgcattattatatgcaagggccgagattcgaaccccggacaccccacttattc |
29841427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 8015854 - 8015916
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||| ||||| ||||||||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
8015854 |
taggataatgcattattacatgcaggggccggggttcgaaccccggacaccccacttattcac |
8015916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 29106114 - 29106052
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| || | ||||||| | |||||||||||||||||| |
|
|
| T |
29106114 |
taggacaatgcattattatatgcaggggccgaagttcgaaccctagacaccccacttattcac |
29106052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 43 - 108
Target Start/End: Complemental strand, 973058 - 972993
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||| ||| ||||||| |||||| ||||||||||| |
|
|
| T |
973058 |
agttggtaggacaatgcattattatatacaggggccggggttcgaaccccggaccccccacttatt |
972993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 6614110 - 6614053
Alignment:
| Q |
53 |
acaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
6614110 |
acaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattca |
6614053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 109
Target Start/End: Original strand, 13862159 - 13862203
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattc |
109 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
13862159 |
ttatatgcaggggtcggagttcgaac-ccggacaccccacttattc |
13862203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 18102012 - 18101963
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||| |||| ||||||| || |||||||||||||||||| |
|
|
| T |
18102012 |
tattatatgcaggggccggagttcgaaccccagacaccccacttattcac |
18101963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 33729790 - 33729859
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| |||||| | |||||||||||||||||| |
|
|
| T |
33729790 |
cagttggtaggacaatgcattattatatgcaggggccggggttcgaatctcagacaccccacttattcac |
33729859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 34010547 - 34010616
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||||||||| ||||||| ||||||| | || |||||||| |
|
|
| T |
34010547 |
cagttggtaggacaatgcattattatatataggggtcggagttcgaaccccggacatctcatttattcac |
34010616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 111
Target Start/End: Original strand, 34729504 - 34729552
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
34729504 |
tattatatgcaggggtcggggttcgaac-ccggacaccccacttattcac |
34729552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 108
Target Start/End: Complemental strand, 19982329 - 19982265
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| | | ||||||| ||| |||||||| ||||| |
|
|
| T |
19982329 |
gttgataggataatgcattattatatgcaggggttgaagttcgaaccccgaacaccccatttatt |
19982265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 20735249 - 20735189
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
20735249 |
ggacaatgcattattatatgtaggggccggggttcgaatcccggacaccccacttattcac |
20735189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 27219645 - 27219577
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||| ||||||||||| ||| ||| ||| ||| ||| ||||||||||||||||| |
|
|
| T |
27219645 |
agttggtaggacaatgcattattatatgcatgggccggggttcaaaccccgtacaccccacttattcac |
27219577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 102
Target Start/End: Original strand, 29050812 - 29050872
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacacccca |
102 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| || |||| |||||||||||| |
|
|
| T |
29050812 |
cagttggtaggacaatgcattattatatgcaggggccggggtttgaactccggacacccca |
29050872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 42618487 - 42618427
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
42618487 |
ggacaatgcattattatatacaggggtcggggttcgaatcccggataccccacttattcac |
42618427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Original strand, 20191475 - 20191522
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
20191475 |
ttatatgcaggggtcggggttcgaaccccggacactccacttattcac |
20191522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 37986936 - 37986881
Alignment:
| Q |
56 |
atgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||| |||||||||||| ||||||| || |||| ||||||| ||||||||||||| |
|
|
| T |
37986936 |
atgcattattatatgcagaggtcggagtttgaaccccggacatcccacttattcac |
37986881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 111
Target Start/End: Complemental strand, 42260781 - 42260734
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| |||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
42260781 |
ttatatgcagggttcgggtttcgaactccggacatcccacttattcac |
42260734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 108
Target Start/End: Original strand, 24205448 - 24205513
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttatt |
108 |
Q |
| |
|
|||||| |||||||||||| | ||||||| ||||||| | || ||||| |||||||||||||||||| |
|
|
| T |
24205448 |
cagttggtaggacaatgcattgttatatgtaggggtcaggtt-cgaaccccggacaccccacttatt |
24205513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 44 - 110
Target Start/End: Complemental strand, 26302574 - 26302509
Alignment:
| Q |
44 |
gttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||| |||||||||||| |||||||| ||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
26302574 |
gttggtaggacaatgcattattatatacagggc-cggagttcgaacctcggacaccccacttattca |
26302509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 3740991 - 3741032
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
3740991 |
ttatatgcaggggtcggggttcgaaccccggacaccccactt |
3741032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 14487573 - 14487642
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||| || ||||||| |||| | ||||||||||||| |
|
|
| T |
14487573 |
cagttggtaggacaatgcattattatatgtaggggttggggttcgaacctcggatatcccacttattcac |
14487642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 16720641 - 16720592
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||||||| ||| ||| ||||||||||||||| ||||| |
|
|
| T |
16720641 |
tattatatgcaggggtcggggttcaaacaccggacaccccacttcttcac |
16720592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 110
Target Start/End: Original strand, 17077400 - 17077441
Alignment:
| Q |
69 |
tgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
17077400 |
tgcaggggtcgggattcgaaccccggacaccccacttattca |
17077441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 22228995 - 22228954
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
22228995 |
ttatatgcaggggtcggagttcgaactccggacactccactt |
22228954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 111
Target Start/End: Complemental strand, 27440381 - 27440312
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||| ||||||| ||| |||||| || ||||||| |
|
|
| T |
27440381 |
cagttggtaggacaatgcattattatatgcagtggtcgaggttcgaaccccgaacaccctacatattcac |
27440312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 38618744 - 38618695
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||| ||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
38618744 |
tattatatgcaagggccggggttcgaaccccggacaccccacttattcac |
38618695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 41319484 - 41319443
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccactt |
105 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
41319484 |
ttatatgcaggggtcggagttcgaaccccggacactccactt |
41319443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1086 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: scaffold1086
Description:
Target: scaffold1086; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 2500 - 2569
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||| | | || |||| ||||||||||||||||||||| |
|
|
| T |
2500 |
cagttggtaggacaatgcattattatatgcagaggttgaagtttgaaccccggacaccccacttattcac |
2569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 111
Target Start/End: Original strand, 16859 - 16927
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||||| ||| |||||| |||||||||| |
|
|
| T |
16859 |
cagttggtaggacaatgcattattatatgcaggggtcgg-gttcgaaccccgaacaccctacttattcac |
16927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0343 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0343
Description:
Target: scaffold0343; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 111
Target Start/End: Original strand, 8573 - 8641
Alignment:
| Q |
43 |
agttgataggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||| || ||||||| ||| |||||| |||||||||| |
|
|
| T |
8573 |
agttgataggacaatgcattattatatgtaggggttggggttcgaaccccgaacaccctacttattcac |
8641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 7097 - 7157
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||| |||||||||||| |||||||| |
|
|
| T |
7097 |
ggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccatttattcac |
7157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 36; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 51 - 110
Target Start/End: Original strand, 25047 - 25106
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||| ||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
25047 |
ggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattca |
25106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 5323 - 5383
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||| | | ||||||| |||||||||||||||||||| |
|
|
| T |
5323 |
taggacaatgcattattatatgcagggg-ccgtgttcgaaccccggacaccccacttattca |
5383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 4879 - 4820
Alignment:
| Q |
51 |
ggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
4879 |
ggacaatgcattattatatgcagggg-cggggttcgaatcccggacaccccacttattcac |
4820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 110
Target Start/End: Complemental strand, 451450 - 451390
Alignment:
| Q |
50 |
aggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||| | ||||||| ||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
451450 |
aggacaatgcattgttatatgtaggggccggggttcgaactccggacaccccacttattca |
451390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 89
Target Start/End: Original strand, 159026 - 159073
Alignment:
| Q |
42 |
cagttgataggacaatgcagtattatatgcaggggtcggatttcgaac |
89 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| |||||||| |
|
|
| T |
159026 |
cagttggtaggacaatgcattattatatgcaggggccgggtttcgaac |
159073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1990 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: scaffold1990
Description:
Target: scaffold1990; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 913 - 975
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| || |||||| || |||||||||||||||||| |
|
|
| T |
913 |
taggacaatgcattattatatgcaggggctggggttcgaatcccagacaccccacttattcac |
975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1112 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: scaffold1112
Description:
Target: scaffold1112; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 64 - 110
Target Start/End: Complemental strand, 2498 - 2452
Alignment:
| Q |
64 |
ttatatgcaggggtcggatttcgaacgccggacaccccacttattca |
110 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
2498 |
ttatatgcaggggtcgggattcgaatcccggacaccccacttattca |
2452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0533 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: scaffold0533
Description:
Target: scaffold0533; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 9345 - 9407
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| |||||| ||| |||| |||||||||||| |
|
|
| T |
9345 |
taggacaatgcattattacatgcaggggtcggggttcgaattccgaacactccacttattcac |
9407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 49 - 111
Target Start/End: Complemental strand, 47393 - 47331
Alignment:
| Q |
49 |
taggacaatgcagtattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| || |||||| || |||||||||||||||||| |
|
|
| T |
47393 |
taggacaatgcattattatatgcaggggctggggttcgaatcccagacaccccacttattcac |
47331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 111
Target Start/End: Complemental strand, 6696 - 6647
Alignment:
| Q |
62 |
tattatatgcaggggtcggatttcgaacgccggacaccccacttattcac |
111 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||||||||| |||||||| |
|
|
| T |
6696 |
tattatatgcaggggccggggttcgaaccccggacaccccaattattcac |
6647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University