View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17988_low_19 (Length: 277)
Name: NF17988_low_19
Description: NF17988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17988_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 12431238 - 12431505
Alignment:
| Q |
1 |
taataaaatcttgcattaaaatttctttacctgttctatttatctttgttttttattgcatccaaaaaagaccagattgcatttttctgttttgtcacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12431238 |
taataaaatcttgcattaaaatttctttacctgttctatttatctttgttttttattgcatccaaaaaagaccagattgcatttttctgttttgtcacaa |
12431337 |
T |
|
| Q |
101 |
gttgcagttgatgggagtaaagtcatgctcaaaatgtctttacatgaattaaaaattacgtctttagtcatgtggatgtaccctcacagacaaagtagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12431338 |
gttgcagttgatgggagtaaagtcatgctcaaaatatctttacataaattaaaaattacatccttagtcatgtggatgtaccctcacagacaaagtagaa |
12431437 |
T |
|
| Q |
201 |
aaccaaaataattgccaatggcttatcctaatgcttcatattgtctacttatgcttgtagatcctctg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||| |
|
|
| T |
12431438 |
aaccaaaataattgccaatggcttatccttatgcttcatattgtctactttatcttgcagatcctctg |
12431505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 26 - 159
Target Start/End: Original strand, 12412978 - 12413124
Alignment:
| Q |
26 |
tttacctgttctatttatcttt---gttttttattgcatccaaaaaagaccagattgcatttttctgttttgt----------cacaagttgcagttgat |
112 |
Q |
| |
|
||||||||| |||| ||||||| |||| ||||||||||||||||||||||| |||| ||||||||||| || |||| ||||||||||| |
|
|
| T |
12412978 |
tttacctgtcctatgtatcttttgtgtttcttattgcatccaaaaaagaccagtttgcttttttctgtttggtaatgacaagtcacagtttgcagttgat |
12413077 |
T |
|
| Q |
113 |
gggagtaaagtcatgctcaaaatgtctttacatgaattaaaaattac |
159 |
Q |
| |
|
||| |||||||| ||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
12413078 |
gggggtaaagtcctgcccaaaatgtcttcacatgagttaaaaattac |
12413124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 268
Target Start/End: Original strand, 12413147 - 12413210
Alignment:
| Q |
205 |
aaaataattgccaatggcttatcctaatgcttcatattgtctacttatgcttgtagatcctctg |
268 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||| ||||| ||||| |||| |||||||||| |
|
|
| T |
12413147 |
aaaatacttaccaatggcttatcctaatgcttcatgctgtcttcttattcttgcagatcctctg |
12413210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University