View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17988_low_20 (Length: 272)
Name: NF17988_low_20
Description: NF17988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17988_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 29220861 - 29220621
Alignment:
| Q |
18 |
acacgatccattagagtctgcaccaactacattaacctcattatagaaaaccatttcttgttgctgttgaagcctcttgtctgttggagcctcaaagaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29220861 |
acacgatccattagagtctgcaccaactacattaacctcattatagaaaaccatttcttgttgctgttgaagcctcttgtctgttggagcctcaaagaat |
29220762 |
T |
|
| Q |
118 |
attgaaacgatgctaatcgtgacatctnnnnnnntctacttccaactaagtagcaaagccaattttctaaggataatatttgcggatatgtccggacatt |
217 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29220761 |
attggaacgatgctaatcgtgacatctaaaaaaatctacttccaactaagtagcaaagccaattttctaaggataatatttgcggatatgaccggacatt |
29220662 |
T |
|
| Q |
218 |
cgacacagttcatatttatcttgactgtttttctaaggcgt |
258 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29220661 |
cgacacagttcatatttatcttaactgtttttctaaggcgt |
29220621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University