View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17988_low_28 (Length: 226)
Name: NF17988_low_28
Description: NF17988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17988_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 1825114 - 1825333
Alignment:
| Q |
7 |
ttatggtttttacaagtatcactaatgatgtttgagacattgtcgttacggacattgaaaagaaatggagcaaggaatgaagcgcatcacgagatatgaa |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1825114 |
ttatggtttttacaagtatcactgatgatgattgagacattgtcgttacggacattgaaaagaaatggagcaaggaatgaagcacatcacgagatatgaa |
1825213 |
T |
|
| Q |
107 |
gatcaggtaaggtgttcgctaccgtctacctcatgtcgcatgctatgagccctgcatcactgagtgtggaatgaaaggcaaatggatttggttatgttga |
206 |
Q |
| |
|
||||||||||||| || |||| ||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1825214 |
gatcaggtaaggttttttctactgtctacctcatgtcgcaggctatgagccatgcatcactaagtgtggaatgaaaggcaaatggatttggttatgttga |
1825313 |
T |
|
| Q |
207 |
cctcgcatcatgattcacat |
226 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
1825314 |
ccttgcatcatgattcacat |
1825333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University