View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_high_17 (Length: 346)
Name: NF1798_high_17
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_high_17 |
 | |
|
| [»] scaffold0013 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0013 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 32 - 338
Target Start/End: Complemental strand, 49870 - 49563
Alignment:
| Q |
32 |
ttgatgtggcggaccagtgaatt-gaaagttacactcttcacaatattacatggtgagcaatgcttataaaaacttgaccgcggtggtatcaatgaagat |
130 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
49870 |
ttgatgtggcggaccagtgagtttgaaagttacactcttcacaatattacatggtgagcaatgcttataaaaacttgactgcggtggtatgaatgaagat |
49771 |
T |
|
| Q |
131 |
atagaccatttattttttagttgtgatttttatggaaaacttttgtcattggattcaagttgcttatgatcttctttagcaactcatagtaatttacagg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
49770 |
atagaccatttattttttagttgtgattttgatggaaaacttttgtcattggattcaagttgcttaggattttctttagcaactcatagtaatttacagg |
49671 |
T |
|
| Q |
231 |
accatctggttcagtttggtggcttaagtggctactcgaaacatgttctcttgacttttaatattatttggctgtcagtagtgtggtttaactgaaaaga |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49670 |
accatctggttcagtttggtggcttaagtggctactcgaaacatgttctcttgacttttaatattatttggctgtcagtagtgtggtttagatgaaaaga |
49571 |
T |
|
| Q |
331 |
gaataata |
338 |
Q |
| |
|
||| |||| |
|
|
| T |
49570 |
gaaaaata |
49563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 239 - 303
Target Start/End: Original strand, 50070132 - 50070196
Alignment:
| Q |
239 |
gttcagtttggtggcttaagtggctactcgaaacatgttctcttgacttttaatattatttggct |
303 |
Q |
| |
|
|||||||||||||| | | |||| || ||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
50070132 |
gttcagtttggtgggtcaggtggttattcgaaacatgtccgattggcttttaatattatttggct |
50070196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University