View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_high_24 (Length: 295)
Name: NF1798_high_24
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 174 - 265
Target Start/End: Original strand, 27218572 - 27218663
Alignment:
| Q |
174 |
tttttacttgaacttatttagtctgagcctctgtagataatagatgcccctttatcgaatgaaatctttaagttcaattagtatttgattta |
265 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27218572 |
tttttacttgaacttatttagttggagcctctgtagataatatatgcccctttatcgaatgaaatctttaagttcaattagtatttgattta |
27218663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 155
Target Start/End: Complemental strand, 39119253 - 39119215
Alignment:
| Q |
117 |
tttatggctcttatgttgctgagttaattttaatgtgtt |
155 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
39119253 |
tttatgcctcttatgttgctaagttaattttaatgtgtt |
39119215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University