View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1798_high_24 (Length: 295)

Name: NF1798_high_24
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1798_high_24
NF1798_high_24
[»] chr6 (1 HSPs)
chr6 (174-265)||(27218572-27218663)
[»] chr5 (1 HSPs)
chr5 (117-155)||(39119215-39119253)


Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 174 - 265
Target Start/End: Original strand, 27218572 - 27218663
Alignment:
174 tttttacttgaacttatttagtctgagcctctgtagataatagatgcccctttatcgaatgaaatctttaagttcaattagtatttgattta 265  Q
    ||||||||||||||||||||||  |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
27218572 tttttacttgaacttatttagttggagcctctgtagataatatatgcccctttatcgaatgaaatctttaagttcaattagtatttgattta 27218663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 155
Target Start/End: Complemental strand, 39119253 - 39119215
Alignment:
117 tttatggctcttatgttgctgagttaattttaatgtgtt 155  Q
    |||||| ||||||||||||| ||||||||||||||||||    
39119253 tttatgcctcttatgttgctaagttaattttaatgtgtt 39119215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University