View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_high_25 (Length: 292)
Name: NF1798_high_25
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 51 - 284
Target Start/End: Complemental strand, 31646416 - 31646169
Alignment:
| Q |
51 |
ggccaacgtcatgctgctgagaacacaattttgaagacaaaaatgccctttgattcatgttgggagatatgtttattcaagctagttaagggtaatttg- |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31646416 |
ggccaacgtcatgctgctgagaacacaattttgaagacaaaaatgccctttgattcatgttgggaaatatgtttattcaagctagttaagggtaatttgg |
31646317 |
T |
 |
| Q |
150 |
-------------attcatgtctggacaaaagccagattggtgatttgattcttaatttctcgttatttcactatctggttattcaagatattatttttt |
236 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
31646316 |
gatatatgtatatatgcatgtctggacaaaagccagattggtgatttaattcttaatttctcgttatttccctatctagttattcaagatattatttttt |
31646217 |
T |
 |
| Q |
237 |
gaccaattggttattcaagattgtatagctagtaataccattcttatc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31646216 |
gaccaattggttattcaagattgtatagctagtaataccattcttatc |
31646169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 55 - 115
Target Start/End: Complemental strand, 31652718 - 31652658
Alignment:
| Q |
55 |
aacgtcatgctgctgagaacacaattttgaagacaaaaatgccctttgattcatgttggga |
115 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
31652718 |
aacgtcatgttgctgagaacataattttgaagacaataataccctttgattcttgttggga |
31652658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University