View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_high_30 (Length: 262)
Name: NF1798_high_30
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_high_30 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 20 - 133
Target Start/End: Original strand, 38123729 - 38123842
Alignment:
| Q |
20 |
acgtaactgtggcatttcaataacgcccgatttcacacaagttgatgggagggttttgcaggctccaagggtattgttactttatcaccgttttcaagaa |
119 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38123729 |
acgtaactgtggcatttcaataacatccgagttcacccaagttgatgggagggttttgcaggctccacgggtattgttactttatcaccgttttcaagaa |
38123828 |
T |
|
| Q |
120 |
aatgccacaataaa |
133 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
38123829 |
aaagccacaataaa |
38123842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 96
Target Start/End: Original strand, 38115414 - 38115490
Alignment:
| Q |
20 |
acgtaactgtggcatttcaataacgcccgatttcacacaagttgatgggagggttttgcaggctccaagggtattgt |
96 |
Q |
| |
|
|||||||||||| ||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38115414 |
acgtaactgtggaatttcaataacatctgggttcacacaagttgatgggagggttttgcaggctccaagggtattgt |
38115490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 179 - 250
Target Start/End: Original strand, 38123900 - 38123971
Alignment:
| Q |
179 |
ttttataatttacttgtgttcccttaaattcttttgatgattgaaaaagaaacatttgccaaattacttttt |
250 |
Q |
| |
|
||||| ||||||| ||||||||||||| |||| ||||||||||| ||||| |||||| |||||||||||||| |
|
|
| T |
38123900 |
ttttaaaatttacatgtgttcccttaacttctcttgatgattgagaaagagacattttccaaattacttttt |
38123971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 179 - 262
Target Start/End: Original strand, 25226215 - 25226298
Alignment:
| Q |
179 |
ttttataatttacttgtgttcccttaaattcttttgatgattgaaaaagaaacatttgccaaattactttttgaagaaaatttt |
262 |
Q |
| |
|
||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
25226215 |
ttttaaaatttacttgtgttcccttaacttctcttgatgattgaaaaagaaacatttgccaaattactttttaaagaaattttt |
25226298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 14916171 - 14916245
Alignment:
| Q |
20 |
acgtaactgtggcatttcaataacgcccgatttcacacaagttgatgggagggttttgcaggctccaagggtatt |
94 |
Q |
| |
|
||||| |||||||||| |||||| || || | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14916171 |
acgtacctgtggcattacaataaaaccgcatcttacacaagttgatgggagggttttgcaggctccaagggtatt |
14916245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University