View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_high_31 (Length: 259)
Name: NF1798_high_31
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 130 - 248
Target Start/End: Complemental strand, 34673074 - 34672956
Alignment:
| Q |
130 |
catatcttgatccaactttttaagtaacgaaatcgtattgatcacttaattatttttatttacaaatattttttctaaaaagtgtaaggattcaccttta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34673074 |
catatcttgatccaactttttaagtaacgaaatcgtattgatcacttaattatttttatttacagatattttttctaaaaagtgtaaggatttaccttta |
34672975 |
T |
 |
| Q |
230 |
aacctatttttaggttcat |
248 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
34672974 |
aatctatttttaggttcat |
34672956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 93
Target Start/End: Complemental strand, 34673186 - 34673111
Alignment:
| Q |
18 |
gaagatgtagtagaaatcggtattatacacactaacacttgcgctaaatcttgatttttaatgtttgctccgcttg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34673186 |
gaagatgtagtagaaatcggtattatacacactaacacttgcgctaaatcttgatttttaatgtttattccgcttg |
34673111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University