View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_high_35 (Length: 249)
Name: NF1798_high_35
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_high_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 61 - 172
Target Start/End: Original strand, 31149205 - 31149317
Alignment:
| Q |
61 |
tttttaat-aaacattaaataactggagttgtcttaccatgtcttttattctttaaacgtaccgatagacacattcaaaacaccttatttgatggtaaaa |
159 |
Q |
| |
|
|||||||| |||||||||| ||| | |||||| |||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31149205 |
tttttaatcaaacattaaacaacggcagttgttttaccatgtccttcattctttaaatgtaccgatagacacattcaaaacaccttatttgatggtataa |
31149304 |
T |
|
| Q |
160 |
atgaatcgcaccc |
172 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
31149305 |
atgaattgcaccc |
31149317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 15303253 - 15303201
Alignment:
| Q |
1 |
gacaaaaatttatgtttttgtcatgtttcttaccacttgtttgtcatgtctct |
53 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || || ||||||| ||||||| |
|
|
| T |
15303253 |
gacaaaaatttatgtttttgtcatgtgtcttgcctctagtttgtcctgtctct |
15303201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University