View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1798_high_35 (Length: 249)

Name: NF1798_high_35
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1798_high_35
NF1798_high_35
[»] chr2 (2 HSPs)
chr2 (61-172)||(31149205-31149317)
chr2 (1-53)||(15303201-15303253)


Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 61 - 172
Target Start/End: Original strand, 31149205 - 31149317
Alignment:
61 tttttaat-aaacattaaataactggagttgtcttaccatgtcttttattctttaaacgtaccgatagacacattcaaaacaccttatttgatggtaaaa 159  Q
    |||||||| |||||||||| ||| | |||||| |||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||| ||    
31149205 tttttaatcaaacattaaacaacggcagttgttttaccatgtccttcattctttaaatgtaccgatagacacattcaaaacaccttatttgatggtataa 31149304  T
160 atgaatcgcaccc 172  Q
    |||||| ||||||    
31149305 atgaattgcaccc 31149317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 15303253 - 15303201
Alignment:
1 gacaaaaatttatgtttttgtcatgtttcttaccacttgtttgtcatgtctct 53  Q
    |||||||||||||||||||||||||| |||| || || ||||||| |||||||    
15303253 gacaaaaatttatgtttttgtcatgtgtcttgcctctagtttgtcctgtctct 15303201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University