View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_high_45 (Length: 237)
Name: NF1798_high_45
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_high_45 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 220
Target Start/End: Complemental strand, 31060529 - 31060318
Alignment:
| Q |
9 |
agagatgaacgacttctcaaatcacttagtgctgaccatgtcttcacaatggtagaaatggacgaaaaccagtcacttgaacttttcagatggcatgctt |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31060529 |
agagatgaacaccttctcaaatcacttagtgctgaccatgtcttcacaatggtagaaatggtcgaaaaccagtcacttgaacttttcagttggcatgctt |
31060430 |
T |
|
| Q |
109 |
tggtcaaccaagtcttatagacgattttagtgaactctctaaatatttttatgcttattggggaaagtccttggttgttacttatctgagaggacaaaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31060429 |
tggtcaaccaagtcttatagacgattttagtgaactctctaaatatttttatgcttattggggaaagtccttggttgttacttatctgagaggacaaaac |
31060330 |
T |
|
| Q |
209 |
aagaccagagga |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31060329 |
aagaccagagga |
31060318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 9 - 109
Target Start/End: Complemental strand, 3400317 - 3400217
Alignment:
| Q |
9 |
agagatgaacgacttctcaaatcacttagtgctgaccatgtcttcacaatggtagaaatggacgaaaaccagtcacttgaacttttcagatggcatgctt |
108 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| ||||||| ||||||||||| ||||||||||||| ||||||| |||||||||||| | |||||||||| |
|
|
| T |
3400317 |
agagatggacgccttctcaaatcacttagtggtgaccatatcttcacaatgacagaaatggacgaagaccagtcccttgaacttttctgttggcatgctt |
3400218 |
T |
|
| Q |
109 |
t |
109 |
Q |
| |
|
| |
|
|
| T |
3400217 |
t |
3400217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 9 - 109
Target Start/End: Original strand, 31174231 - 31174331
Alignment:
| Q |
9 |
agagatgaacgacttctcaaatcacttagtgctgaccatgtcttcacaatggtagaaatggacgaaaaccagtcacttgaacttttcagatggcatgctt |
108 |
Q |
| |
|
||||||| ||| |||||||| |||||||||| |||||| ||||||||||| ||||||||| || ||||||| |||||||||||| | |||||||||| |
|
|
| T |
31174231 |
agagatgcacgccttctcaactcacttagtgacgaccatatcttcacaatgacggaaatggacaaataccagtcccttgaacttttctgttggcatgctt |
31174330 |
T |
|
| Q |
109 |
t |
109 |
Q |
| |
|
| |
|
|
| T |
31174331 |
t |
31174331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 109
Target Start/End: Complemental strand, 8373388 - 8373327
Alignment:
| Q |
48 |
gtcttcacaatggtagaaatggacgaaaaccagtcacttgaacttttcagatggcatgcttt |
109 |
Q |
| |
|
|||||||||||| | |||||||| ||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
8373388 |
gtcttcacaatgattgaaatggataaaaacgagtcccttgaacttttcagctggcatgcttt |
8373327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University