View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_high_53 (Length: 218)
Name: NF1798_high_53
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 68 - 200
Target Start/End: Complemental strand, 7889244 - 7889112
Alignment:
| Q |
68 |
tggtggaacttattctttatttttcatctgaatcttttcttattacaggggaaccatcttagacacaaattagacaacctgataacgatggtaatgatca |
167 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7889244 |
tggtggaacttattctttattttccatctgaatcttttcttatcacaagggaaccaacttagacacaaattagacaacctgataacgatggtaatgatca |
7889145 |
T |
 |
| Q |
168 |
acagcaacatccccgttagttccatccaatatt |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
7889144 |
acagcaacatccccattagttccatccaatatt |
7889112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University