View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_low_33 (Length: 305)
Name: NF1798_low_33
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 283
Target Start/End: Original strand, 34852093 - 34852376
Alignment:
| Q |
9 |
caacaaaatattgttcactatatttcttttcttcttctctaagattgacttggtgtatgtttggtatcatactggatatacccgaatcacggttatccaa |
108 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34852093 |
caacaaaatattgttcaccgtatttcttttcttcttctctaagattgacttggtgtatgtttggtatcatactggatatacccgaatcacggttatccaa |
34852192 |
T |
 |
| Q |
109 |
cgtgattttgcaaaagctacgaagtataatttttaaaatatcgtggtggatcaccacatgattctacatacataccataatac---------gctaggta |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
34852193 |
cgtgattttgcaaaagctacggagtataatttttaaaatatcgtggtggatcgccacgtgattctacatacataccataataccaaacataggctaggta |
34852292 |
T |
 |
| Q |
200 |
tatttcgcttaaaataacgagtgagagctagttgtgaacttgagattatttgaaattgattttgttattgtgtaatctaaatat |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34852293 |
tatttcgcttaaaataaggagtgagagctagttgtgaacttgagattatttgaaattgattttgttattgtgtaatctaaatat |
34852376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 61 - 128
Target Start/End: Original strand, 30808435 - 30808502
Alignment:
| Q |
61 |
gtgtatgtttggtatcatactggatatacccgaatcacggttatccaacgtgattttgcaaaagctac |
128 |
Q |
| |
|
|||| ||||||||||||| |||||||| | |||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
30808435 |
gtgtgtgtttggtatcatggtggatatatcagaatcacggtgatccatcgtgattttgaaaaagctac |
30808502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University