View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_low_36 (Length: 285)
Name: NF1798_low_36
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_low_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 217 - 257
Target Start/End: Complemental strand, 1693567 - 1693527
Alignment:
| Q |
217 |
actaactatccccccaaaaacataactaactaactaaccaa |
257 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1693567 |
actaactatccctccaaaaacataactaactaactaaccaa |
1693527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 189
Target Start/End: Complemental strand, 52791818 - 52791768
Alignment:
| Q |
139 |
gtatattctatatcataaaaatatggaattggagatcgaaacccttggttt |
189 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
52791818 |
gtatattctatatgatagaaatatggatttggagatcgataccctgggttt |
52791768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University