View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_low_51 (Length: 244)
Name: NF1798_low_51
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_low_51 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 33228741 - 33228501
Alignment:
| Q |
1 |
ggagacaaggttgaaaagggtatctctatcatatttctcattatcattgacatgggtgagataaactttgttaaggatatcaatatcctcaagcttaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33228741 |
ggagacaaggttgaaaagggtatccctatcatatttcatattatcattgacatgggtgagataaactttgttaaggatttcaatatcctcaagcttaaag |
33228642 |
T |
 |
| Q |
101 |
ggattagggagctgagatttctgttgttgggaggtatcattcttttgggtcgtagtgccactgattggtacattataggaggacaatgcagtggacatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33228641 |
ggattagggagctgagatttctgttgttgggaggtatcattcttttgggtcgtagtgccactgattggtacattat---aggacaatgcagtggacatgg |
33228545 |
T |
 |
| Q |
201 |
tgatgatttgtttataaattaataagatttgatataagtaatta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33228544 |
tgatgatttgtttataaattaataagatttgatataagtaatta |
33228501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University