View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_low_53 (Length: 238)
Name: NF1798_low_53
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 72 - 221
Target Start/End: Complemental strand, 33228388 - 33228239
Alignment:
| Q |
72 |
caaggtagcttcttcattagtggtctataaacgtgaaacatgattttatgatgtggttttcataatataccctcacatgactatgtttgttggtatgtga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33228388 |
caaggtagcttcttcattagtggtctataaacgtgaaacatgattttatgatgtggttttcataatataccctcacatgactatgtttgttggtatgtga |
33228289 |
T |
|
| Q |
172 |
aattggatttatattagggatttcattgtcatttaactgaaattatttca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33228288 |
aattggatttatattagggatttcattgtcatttaactgaaattatttca |
33228239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 33228459 - 33228418
Alignment:
| Q |
1 |
ttcccctatttatacttgacatgtttaatagacaaatatttc |
42 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33228459 |
ttcctctatttatacttgacatgtttaacagacaaatatttc |
33228418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University