View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_low_54 (Length: 238)
Name: NF1798_low_54
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_low_54 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 14661254 - 14661032
Alignment:
| Q |
16 |
cagtaattgataaacaaccttgtttgatatcgaactcgtgattcttggataaatgtcagaagggaaaaacacacaagatttgatacaatgcctaggacgt |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14661254 |
cagtaattgataaacaactttgtttgataccgaaatcttgattcttggataaatgtcagaagggaaaaacacacaagatttcatacaatgcctaggacgt |
14661155 |
T |
 |
| Q |
116 |
gacatgtccattgatgtttttaaccatttaaatttgaatgacccatgcgaccttattcgtgcatctgctgtttctaaatcttggtaccaatttggtaagc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14661154 |
gacatgtccattgatgtttttaaccatttgaatttgaatgacccatgcgaccttattcgtgcatctgctgtttctaaatcttggtaccaatttggtaagc |
14661055 |
T |
 |
| Q |
216 |
catttgattacctatcaaatgat |
238 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
14661054 |
catttgattagctatcaaatgat |
14661032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 148 - 224
Target Start/End: Original strand, 41770 - 41846
Alignment:
| Q |
148 |
tttgaatgacccatgcgaccttattcgtgcatctgctgtttctaaatcttggtaccaatttggtaagccatttgatt |
224 |
Q |
| |
|
|||| |||||| ||| ||||| |||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41770 |
tttggatgaccgatgtgacctcgttcgtgtatctgctgtttctaaatcttggtaccgatttggtaagccatttgatt |
41846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University