View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_low_58 (Length: 237)
Name: NF1798_low_58
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 1004432 - 1004278
Alignment:
| Q |
1 |
aacagtgtatcaaaataaatgaatgaataaataaacttgcctggttcaacgggcattttttatgaataaagtgatggtccgaagcatcattaacaaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1004432 |
aacagtgtatcaaaataaatgaatgaataaataaacttgcctggttcaacgggcattttttatgaataaagtgatggtccgaagcatcattaacaaagtc |
1004333 |
T |
 |
| Q |
101 |
aaattgcttaaaacttgggaattttttgaagatttcatctttggttttcattgac |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1004332 |
aaattgcttaaaacttgggaattttttgaagatttcatctttggttttcattgac |
1004278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 1004264 - 1004220
Alignment:
| Q |
178 |
catctttgatattggcatggtatgaactgctactgccagtttcct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1004264 |
catctttgatattggcatggtatgaactgctactgccggtttcct |
1004220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University