View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1798_low_65 (Length: 209)
Name: NF1798_low_65
Description: NF1798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1798_low_65 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 24 - 130
Target Start/End: Complemental strand, 23129114 - 23129008
Alignment:
| Q |
24 |
gttcgagtaccagctgggcttgttttatcgttgaggtagagaaaaatatgcttaattttgctacttattctatttttgattacagcaaagtaattactta |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23129114 |
gttcgagtaccagctgggcttgttttatcgttgaggtagagaaaaatatgcttaattttgctacttattctatttttgattacagcaaagtaattactta |
23129015 |
T |
|
| Q |
124 |
cactaaa |
130 |
Q |
| |
|
||||||| |
|
|
| T |
23129014 |
cactaaa |
23129008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University