View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_high_31 (Length: 234)
Name: NF17990_high_31
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 12690295 - 12690094
Alignment:
| Q |
13 |
gtgagatgaatttggaggtttggaaacgttttaccaatcgtggctattgagatggcatacaggagctattctcataacagttaattgtgtatgattatat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12690295 |
gtgagatgaatttggaggtttggaaacgttttaccaatcgtggctattgagatggcatacaggagctattctcataacaattaattgtgtatgattatat |
12690196 |
T |
 |
| Q |
113 |
atttaattgaaacgatgcaaaataatagaggaacttttatcgtatatgccgatgtctcaaacatgtgaacacacttattttgaagcttttcaaacatcga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12690195 |
atttaattgaaacgatgcaaaataatagaggaacttttatcgtatacgctgatgtctccaacatgtgaacacacttattttaaagcttttcaaacatcga |
12690096 |
T |
 |
| Q |
213 |
tg |
214 |
Q |
| |
|
|| |
|
|
| T |
12690095 |
tg |
12690094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 210
Target Start/End: Original strand, 20678556 - 20678591
Alignment:
| Q |
175 |
atgtgaacacacttattttgaagcttttcaaacatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20678556 |
atgtgaacacacttattttgaagcttttcaaacatc |
20678591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University