View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_high_32 (Length: 229)
Name: NF17990_high_32
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 5504617 - 5504810
Alignment:
| Q |
18 |
agggcgggggactggaaaactagcatgatagggtggcggaaaacggagatgctatcttaatctgtaccatactccctggattgaatagaactctgcctcg |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||| |||| |
|
|
| T |
5504617 |
agggtgggggactggaaaactagcatgacagggtggcggaaaatggagatgctatcttaatctgtatcatactcgctggattgaatagaactctggctcg |
5504716 |
T |
 |
| Q |
118 |
agtttatat-aagttcattatccaaatatgatgaaataaattcaagaaccgatgctattacataacttaataatttcataacacgtagctgggaa |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5504717 |
agtttatatcaagttcattatccaaatatgatgaaataaattc-agaaccgatgctattacataacttaataatttcataacacgtagctgggaa |
5504810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 152
Target Start/End: Original strand, 11812269 - 11812353
Alignment:
| Q |
69 |
ctatcttaatctgtaccatactccctggattgaatagaactctgcctcgagtttatat-aagttcattatccaaatatgatgaaa |
152 |
Q |
| |
|
||||||||| |||| ||||||| |||| ||||||||| ||| |||||||||||||| ||||| || ||||||||||| ||||| |
|
|
| T |
11812269 |
ctatcttaacttgtatcatactctctgggttgaatagacctcgccctcgagtttatatcaagtttatcatccaaatatggtgaaa |
11812353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University