View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17990_high_34 (Length: 220)

Name: NF17990_high_34
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17990_high_34
NF17990_high_34
[»] chr6 (1 HSPs)
chr6 (64-203)||(28699027-28699166)


Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 64 - 203
Target Start/End: Original strand, 28699027 - 28699166
Alignment:
64 agttccatattaattagccgaattctttaatattaattagcctctaaactagcagatggagattctggatgatgtgatttccgataaggctgaacttgag 163  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
28699027 agttccatattaattagccgagttctttaatattaattagcctctaaactagcagatggagattctggatgatgtgctttccgataaggctgaacttgag 28699126  T
164 gaccagcttgtggagcagcaaatggaacttgaatggctga 203  Q
    ||||||||||||||||||||||||||||||||||||||||    
28699127 gaccagcttgtggagcagcaaatggaacttgaatggctga 28699166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University