View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_high_34 (Length: 220)
Name: NF17990_high_34
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_high_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 64 - 203
Target Start/End: Original strand, 28699027 - 28699166
Alignment:
| Q |
64 |
agttccatattaattagccgaattctttaatattaattagcctctaaactagcagatggagattctggatgatgtgatttccgataaggctgaacttgag |
163 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28699027 |
agttccatattaattagccgagttctttaatattaattagcctctaaactagcagatggagattctggatgatgtgctttccgataaggctgaacttgag |
28699126 |
T |
|
| Q |
164 |
gaccagcttgtggagcagcaaatggaacttgaatggctga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28699127 |
gaccagcttgtggagcagcaaatggaacttgaatggctga |
28699166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University