View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_high_37 (Length: 201)
Name: NF17990_high_37
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 22 - 153
Target Start/End: Original strand, 16009706 - 16009837
Alignment:
| Q |
22 |
gaggagcacagacactataaacaaacctggccaagttgtttcataaaatcgagtatttcaggacgagcaccaataccagttgaccaaactaccatcccat |
121 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16009706 |
gaggaacacggacactataaacaaacctggccaagttgtttcataaaatcgagtatttcaggacgagcaccaataccagttgaccaaactaccatcccat |
16009805 |
T |
 |
| Q |
122 |
gaggcatagtaacaacttgaccactttctctt |
153 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |
|
|
| T |
16009806 |
gaggcatagtaacaacctgaccactttctctt |
16009837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University